Incidental Mutation 'R7227:Nucb2'
ID562226
Institutional Source Beutler Lab
Gene Symbol Nucb2
Ensembl Gene ENSMUSG00000030659
Gene Namenucleobindin 2
SynonymsNEFA, Calnuc, nesfatin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7227 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location116504369-116540584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116526076 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 123 (D123V)
Ref Sequence ENSEMBL: ENSMUSP00000032895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032895] [ENSMUST00000183175]
Predicted Effect probably damaging
Transcript: ENSMUST00000032895
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032895
Gene: ENSMUSG00000030659
AA Change: D123V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
EFh 245 273 5.63e-1 SMART
EFh 297 325 6.56e0 SMART
coiled coil region 341 403 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183175
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138741
Gene: ENSMUSG00000030659
AA Change: D123V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
EFh 245 273 5.63e-1 SMART
EFh 297 325 6.56e0 SMART
coiled coil region 341 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183335
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a suggested role in calcium level maintenance, eating regulation in the hypothalamus, and release of tumor necrosis factor from vascular endothelial cells. This protein binds calcium and has EF-folding domains. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased heart rate and increased serum alkaline phosphatase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G T 1: 93,152,014 N451K probably benign Het
2310057M21Rik A T 7: 131,350,720 L344H probably damaging Het
Abcb1b T A 5: 8,825,593 S589T probably damaging Het
Acsm2 A C 7: 119,591,333 I520L probably benign Het
Ap2a2 T C 7: 141,620,871 Y544H probably damaging Het
Ascc1 T A 10: 60,007,738 Y41N probably benign Het
Bend3 T A 10: 43,511,405 L598Q probably damaging Het
Cfap74 T G 4: 155,460,948 Y1108* probably null Het
Cxcl17 C A 7: 25,402,894 R41S probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Dnah2 A G 11: 69,421,396 Y4370H probably damaging Het
Dzip3 T A 16: 48,951,569 Q579L probably damaging Het
Enpp3 C T 10: 24,817,844 M195I unknown Het
Esyt2 A G 12: 116,342,125 D325G probably damaging Het
Fat1 T G 8: 45,010,609 I1396S probably benign Het
Gigyf1 T A 5: 137,523,823 I661K unknown Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Hivep1 T C 13: 42,156,911 S876P probably benign Het
Hk3 C T 13: 55,012,240 R362H probably benign Het
Ier3ip1 T A 18: 76,939,634 M53K probably benign Het
Klhl5 T C 5: 65,141,288 S137P probably benign Het
Kremen2 G T 17: 23,744,599 Y70* probably null Het
Lag3 C T 6: 124,908,494 G308S possibly damaging Het
Map4k2 T A 19: 6,346,594 L542Q probably damaging Het
Mef2d G A 3: 88,158,207 probably null Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mpp3 T A 11: 102,005,078 Y457F possibly damaging Het
Mrpl12 T A 11: 120,488,352 I175N probably damaging Het
Mybbp1a G T 11: 72,447,759 K728N possibly damaging Het
Nfkb1 C T 3: 135,626,659 V112M probably damaging Het
Olfr527 A G 7: 140,335,621 probably benign Het
Orc3 T C 4: 34,572,542 T629A probably benign Het
Pdk1 T A 2: 71,883,901 N218K possibly damaging Het
Plce1 A G 19: 38,726,902 T1298A probably benign Het
Ppan T A 9: 20,888,200 probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Scn2a A C 2: 65,752,023 I1572L probably damaging Het
Sec16a A T 2: 26,438,923 Y1027N probably benign Het
Serpinb3a T A 1: 107,051,629 T48S probably damaging Het
Slc30a8 A G 15: 52,331,636 M264V probably benign Het
Slc44a3 A T 3: 121,510,230 C286S possibly damaging Het
Slc8a2 T C 7: 16,144,981 I464T possibly damaging Het
Smco1 T C 16: 32,274,015 M168T possibly damaging Het
Spns2 A T 11: 72,458,687 Y246* probably null Het
Ssbp2 T C 13: 91,675,125 M213T probably benign Het
Stk40 G T 4: 126,123,766 A29S probably benign Het
Thrap3 A T 4: 126,173,503 F683I probably damaging Het
Tmc5 A G 7: 118,670,666 T880A possibly damaging Het
Trim38 T A 13: 23,785,963 N168K possibly damaging Het
Ube2d1 T A 10: 71,255,872 Y134F possibly damaging Het
Vmn1r67 T A 7: 10,447,548 Y246* probably null Het
Vmn2r18 T C 5: 151,572,799 T485A probably damaging Het
Wrn T A 8: 33,248,946 I1285F probably damaging Het
Xrcc1 C A 7: 24,547,332 H8Q probably damaging Het
Zkscan4 T C 13: 21,484,243 V317A probably benign Het
Other mutations in Nucb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Nucb2 APN 7 116521831 splice site probably benign
IGL02347:Nucb2 APN 7 116535878 missense probably benign 0.00
R0017:Nucb2 UTSW 7 116533151 missense probably benign 0.01
R0017:Nucb2 UTSW 7 116533151 missense probably benign 0.01
R0207:Nucb2 UTSW 7 116536010 missense probably damaging 1.00
R0690:Nucb2 UTSW 7 116535851 splice site probably benign
R1526:Nucb2 UTSW 7 116524407 critical splice donor site probably null
R3964:Nucb2 UTSW 7 116528875 missense probably damaging 1.00
R3966:Nucb2 UTSW 7 116528875 missense probably damaging 1.00
R4154:Nucb2 UTSW 7 116527667 missense probably benign 0.00
R4619:Nucb2 UTSW 7 116527824 critical splice donor site probably null
R4705:Nucb2 UTSW 7 116540027 critical splice donor site probably null
R4913:Nucb2 UTSW 7 116524305 nonsense probably null
R4934:Nucb2 UTSW 7 116539964 missense possibly damaging 0.93
R5210:Nucb2 UTSW 7 116528987 missense probably damaging 1.00
R7776:Nucb2 UTSW 7 116529013 missense probably damaging 1.00
R7899:Nucb2 UTSW 7 116521970 missense probably benign 0.01
R8200:Nucb2 UTSW 7 116533163 critical splice donor site probably null
R8743:Nucb2 UTSW 7 116528830 missense probably damaging 1.00
R8818:Nucb2 UTSW 7 116521901 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGTATCCAACTCAGTCAACCTATTACC -3'
(R):5'- ATTAACCTCTGGCTCTACACAC -3'

Sequencing Primer
(F):5'- CATGCAGTGTCCATAGATGTCAGC -3'
(R):5'- TCTACACACAGGCACATATGAGTGTG -3'
Posted On2019-06-26