Incidental Mutation 'R0576:Rxfp2'
ID56224
Institutional Source Beutler Lab
Gene Symbol Rxfp2
Ensembl Gene ENSMUSG00000053368
Gene Namerelaxin/insulin-like family peptide receptor 2
SynonymsGpr106, Great, LGR8
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0576 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150018675-150082184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 150038247 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 77 (H77Q)
Ref Sequence ENSEMBL: ENSMUSP00000106122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]
Predicted Effect probably benign
Transcript: ENSMUST00000065745
AA Change: H77Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368
AA Change: H77Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 8.98e1 SMART
LRR_TYP 287 310 2.24e-3 SMART
LRR 311 334 1.15e1 SMART
LRR 335 358 2.14e1 SMART
Pfam:7tm_1 415 674 1.4e-26 PFAM
low complexity region 682 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110496
AA Change: H77Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368
AA Change: H77Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 2.82e0 SMART
LRR 287 310 1.15e1 SMART
LRR 311 334 2.14e1 SMART
Pfam:7tm_1 391 650 1.5e-27 PFAM
low complexity region 658 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143989
Predicted Effect probably benign
Transcript: ENSMUST00000201612
AA Change: H77Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368
AA Change: H77Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 1.3e-13 SMART
LRRNT 93 124 1.9e-2 SMART
LRR 120 142 7.4e-1 SMART
LRR 143 166 2.9e-2 SMART
LRR_TYP 167 190 1.2e-7 SMART
LRR 229 252 5.4e-2 SMART
LRR 253 276 1.1e-1 SMART
LRR 277 300 1.2e-2 SMART
LRR 301 324 5e-2 SMART
LRR 325 348 9.3e-2 SMART
Pfam:7tm_1 405 664 1.5e-24 PFAM
low complexity region 672 685 N/A INTRINSIC
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Rxfp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rxfp2 APN 5 150066428 missense probably benign
IGL00984:Rxfp2 APN 5 150067132 missense probably benign 0.24
IGL02475:Rxfp2 APN 5 150063686 missense probably benign 0.07
IGL02637:Rxfp2 APN 5 150055913 missense probably damaging 0.99
IGL02992:Rxfp2 APN 5 150051556 missense probably benign 0.01
IGL03052:Rxfp2 APN 5 150043180 splice site probably benign
IGL03203:Rxfp2 APN 5 150063680 missense probably benign 0.08
R0158:Rxfp2 UTSW 5 150051628 missense probably benign 0.14
R0394:Rxfp2 UTSW 5 150067388 missense probably benign 0.03
R0499:Rxfp2 UTSW 5 150066415 missense probably damaging 1.00
R0720:Rxfp2 UTSW 5 150044119 missense probably benign 0.04
R1172:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1173:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1174:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1175:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1606:Rxfp2 UTSW 5 150059897 missense probably benign
R1720:Rxfp2 UTSW 5 150043099 nonsense probably null
R2040:Rxfp2 UTSW 5 150070212 missense probably benign
R3029:Rxfp2 UTSW 5 150043130 missense probably benign 0.05
R3905:Rxfp2 UTSW 5 150055985 splice site probably null
R4056:Rxfp2 UTSW 5 150051633 critical splice donor site probably null
R4156:Rxfp2 UTSW 5 150051555 missense probably benign 0.01
R4282:Rxfp2 UTSW 5 150070270 missense possibly damaging 0.94
R4418:Rxfp2 UTSW 5 150048800 missense probably benign
R4935:Rxfp2 UTSW 5 150051632 critical splice donor site probably null
R5010:Rxfp2 UTSW 5 150067360 missense probably damaging 1.00
R5286:Rxfp2 UTSW 5 150035444 missense probably damaging 1.00
R5373:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5374:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5530:Rxfp2 UTSW 5 150056810 missense probably damaging 1.00
R5844:Rxfp2 UTSW 5 150043124 missense probably benign 0.00
R6021:Rxfp2 UTSW 5 150063737 missense possibly damaging 0.46
R6211:Rxfp2 UTSW 5 150044126 splice site probably null
R6401:Rxfp2 UTSW 5 150043130 missense probably benign
R6841:Rxfp2 UTSW 5 150018745 start gained probably benign
R6981:Rxfp2 UTSW 5 150048848 splice site probably null
R7012:Rxfp2 UTSW 5 150081194 missense probably benign 0.00
R7032:Rxfp2 UTSW 5 150070348 missense probably damaging 1.00
R7151:Rxfp2 UTSW 5 150043107 missense probably benign 0.01
R7205:Rxfp2 UTSW 5 150059899 missense probably benign 0.05
R7205:Rxfp2 UTSW 5 150059903 missense probably benign 0.00
R7209:Rxfp2 UTSW 5 150053098 intron probably null
R7468:Rxfp2 UTSW 5 150067336 missense possibly damaging 0.70
R7475:Rxfp2 UTSW 5 150049581 missense possibly damaging 0.94
R8181:Rxfp2 UTSW 5 150063736 missense probably benign 0.22
R8258:Rxfp2 UTSW 5 150059900 missense probably damaging 0.97
R8259:Rxfp2 UTSW 5 150059900 missense probably damaging 0.97
X0067:Rxfp2 UTSW 5 150051618 missense probably damaging 1.00
Z1177:Rxfp2 UTSW 5 150048810 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGGAGCGCACGTTTGAAATC -3'
(R):5'- AGGACATCGACCTTCTGAAGGCAG -3'

Sequencing Primer
(F):5'- TGAAATCCTTGTGAAAACAACCG -3'
(R):5'- gcttgaaaccagagataatgcc -3'
Posted On2013-07-11