Incidental Mutation 'R7227:Spns2'
ID562241
Institutional Source Beutler Lab
Gene Symbol Spns2
Ensembl Gene ENSMUSG00000040447
Gene Namespinster homolog 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7227 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72451638-72489904 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 72458687 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 246 (Y246*)
Ref Sequence ENSEMBL: ENSMUSP00000044418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303]
Predicted Effect probably null
Transcript: ENSMUST00000045303
AA Change: Y246*
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447
AA Change: Y246*

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144940
SMART Domains Protein: ENSMUSP00000120722
Gene: ENSMUSG00000040447

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transporter of sphingosine 1-phosphate, a secreted lipid that is important in cardiovascular, immunological, and neural development. Defects in this gene are a cause of early onset progressive hearing loss. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit symblepharon and impaired egress of T and B cells from the thymus and bone marrow, respectively. Mice homozygous for a different knock-out allele exhibit abnormal immune system, abnormal eye morphology and absent pinna reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G T 1: 93,152,014 N451K probably benign Het
2310057M21Rik A T 7: 131,350,720 L344H probably damaging Het
Abcb1b T A 5: 8,825,593 S589T probably damaging Het
Acsm2 A C 7: 119,591,333 I520L probably benign Het
Ap2a2 T C 7: 141,620,871 Y544H probably damaging Het
Ascc1 T A 10: 60,007,738 Y41N probably benign Het
Bend3 T A 10: 43,511,405 L598Q probably damaging Het
Cfap74 T G 4: 155,460,948 Y1108* probably null Het
Cxcl17 C A 7: 25,402,894 R41S probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Dnah2 A G 11: 69,421,396 Y4370H probably damaging Het
Dzip3 T A 16: 48,951,569 Q579L probably damaging Het
Enpp3 C T 10: 24,817,844 M195I unknown Het
Esyt2 A G 12: 116,342,125 D325G probably damaging Het
Fat1 T G 8: 45,010,609 I1396S probably benign Het
Gigyf1 T A 5: 137,523,823 I661K unknown Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Hivep1 T C 13: 42,156,911 S876P probably benign Het
Hk3 C T 13: 55,012,240 R362H probably benign Het
Ier3ip1 T A 18: 76,939,634 M53K probably benign Het
Klhl5 T C 5: 65,141,288 S137P probably benign Het
Kremen2 G T 17: 23,744,599 Y70* probably null Het
Lag3 C T 6: 124,908,494 G308S possibly damaging Het
Map4k2 T A 19: 6,346,594 L542Q probably damaging Het
Mef2d G A 3: 88,158,207 probably null Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mpp3 T A 11: 102,005,078 Y457F possibly damaging Het
Mrpl12 T A 11: 120,488,352 I175N probably damaging Het
Mybbp1a G T 11: 72,447,759 K728N possibly damaging Het
Nfkb1 C T 3: 135,626,659 V112M probably damaging Het
Nucb2 A T 7: 116,526,076 D123V probably damaging Het
Olfr527 A G 7: 140,335,621 probably benign Het
Orc3 T C 4: 34,572,542 T629A probably benign Het
Pdk1 T A 2: 71,883,901 N218K possibly damaging Het
Plce1 A G 19: 38,726,902 T1298A probably benign Het
Ppan T A 9: 20,888,200 probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Scn2a A C 2: 65,752,023 I1572L probably damaging Het
Sec16a A T 2: 26,438,923 Y1027N probably benign Het
Serpinb3a T A 1: 107,051,629 T48S probably damaging Het
Slc30a8 A G 15: 52,331,636 M264V probably benign Het
Slc44a3 A T 3: 121,510,230 C286S possibly damaging Het
Slc8a2 T C 7: 16,144,981 I464T possibly damaging Het
Smco1 T C 16: 32,274,015 M168T possibly damaging Het
Ssbp2 T C 13: 91,675,125 M213T probably benign Het
Stk40 G T 4: 126,123,766 A29S probably benign Het
Thrap3 A T 4: 126,173,503 F683I probably damaging Het
Tmc5 A G 7: 118,670,666 T880A possibly damaging Het
Trim38 T A 13: 23,785,963 N168K possibly damaging Het
Ube2d1 T A 10: 71,255,872 Y134F possibly damaging Het
Vmn1r67 T A 7: 10,447,548 Y246* probably null Het
Vmn2r18 T C 5: 151,572,799 T485A probably damaging Het
Wrn T A 8: 33,248,946 I1285F probably damaging Het
Xrcc1 C A 7: 24,547,332 H8Q probably damaging Het
Zkscan4 T C 13: 21,484,243 V317A probably benign Het
Other mutations in Spns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Spns2 APN 11 72456510 missense possibly damaging 0.79
IGL01804:Spns2 APN 11 72457304 missense possibly damaging 0.89
elderly UTSW 11 72456370 critical splice acceptor site probably null
homely UTSW 11 72456860 missense probably damaging 1.00
whistler UTSW 11 72458687 nonsense probably null
Wrinkled UTSW 11 72456878 missense possibly damaging 0.81
R0883:Spns2 UTSW 11 72454397 missense probably damaging 1.00
R1544:Spns2 UTSW 11 72456367 missense probably benign 0.30
R1696:Spns2 UTSW 11 72456347 missense probably benign 0.25
R2046:Spns2 UTSW 11 72459040 missense possibly damaging 0.49
R2164:Spns2 UTSW 11 72458671 missense possibly damaging 0.82
R2259:Spns2 UTSW 11 72457268 missense probably benign 0.35
R4209:Spns2 UTSW 11 72454186 missense probably benign 0.07
R5285:Spns2 UTSW 11 72489479 missense possibly damaging 0.92
R6883:Spns2 UTSW 11 72456370 critical splice acceptor site probably null
R6990:Spns2 UTSW 11 72489621 missense probably benign 0.08
R7221:Spns2 UTSW 11 72456916 missense probably benign 0.43
R7243:Spns2 UTSW 11 72456860 missense probably damaging 1.00
R7390:Spns2 UTSW 11 72456878 missense possibly damaging 0.81
R7699:Spns2 UTSW 11 72489617 nonsense probably null
R7700:Spns2 UTSW 11 72489617 nonsense probably null
R8042:Spns2 UTSW 11 72454177 missense possibly damaging 0.46
R8155:Spns2 UTSW 11 72456568 missense possibly damaging 0.46
R8553:Spns2 UTSW 11 72457227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGGAGACAAGACCTAGAGCC -3'
(R):5'- GGCAGGTAAGTGTGAACTGC -3'

Sequencing Primer
(F):5'- AGACCTAGAGCCCAGGC -3'
(R):5'- GTACCAAGGTTCCCTAGAATTTACC -3'
Posted On2019-06-26