Incidental Mutation 'R0576:Copg1'
ID56227
Institutional Source Beutler Lab
Gene Symbol Copg1
Ensembl Gene ENSMUSG00000030058
Gene Namecoatomer protein complex, subunit gamma 1
SynonymsD6Ertd71e, Copg, D6Wsu16e
MMRRC Submission 038766-MU
Accession Numbers

Genbank: NM_017477, NM_201244; MGI: 1858696

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0576 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87887814-87913595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87897963 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 380 (V380D)
Ref Sequence ENSEMBL: ENSMUSP00000109237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113607]
Predicted Effect probably damaging
Transcript: ENSMUST00000113607
AA Change: V380D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109237
Gene: ENSMUSG00000030058
AA Change: V380D

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 4.1e-135 PFAM
Pfam:COP-gamma_platf 611 759 7.6e-64 PFAM
Pfam:Coatomer_g_Cpla 761 873 1.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205234
Meta Mutation Damage Score 0.9598 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI

All alleles(58) : Targeted, other(2) Gene trapped(56)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Copg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Copg1 APN 6 87902370 missense possibly damaging 0.94
IGL00816:Copg1 APN 6 87893898 missense possibly damaging 0.95
IGL02087:Copg1 APN 6 87902210 missense possibly damaging 0.68
R0194:Copg1 UTSW 6 87904197 splice site probably benign
R0448:Copg1 UTSW 6 87904926 missense probably benign
R0701:Copg1 UTSW 6 87894107 nonsense probably null
R1251:Copg1 UTSW 6 87890007 nonsense probably null
R1707:Copg1 UTSW 6 87905210 missense probably benign
R1845:Copg1 UTSW 6 87893818 missense probably damaging 1.00
R3500:Copg1 UTSW 6 87895923 splice site probably benign
R3952:Copg1 UTSW 6 87905216 missense probably benign
R4283:Copg1 UTSW 6 87908545 missense probably damaging 1.00
R4515:Copg1 UTSW 6 87907546 intron probably benign
R4715:Copg1 UTSW 6 87912286 nonsense probably null
R4797:Copg1 UTSW 6 87903468 intron probably benign
R4864:Copg1 UTSW 6 87889696 missense probably damaging 1.00
R4947:Copg1 UTSW 6 87903473 splice site probably benign
R5265:Copg1 UTSW 6 87892270 missense probably damaging 0.98
R5288:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5386:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5511:Copg1 UTSW 6 87912294 missense probably damaging 0.99
R5670:Copg1 UTSW 6 87912235 missense probably damaging 1.00
R5887:Copg1 UTSW 6 87902297 missense probably damaging 1.00
R7014:Copg1 UTSW 6 87902340 missense probably damaging 1.00
R7021:Copg1 UTSW 6 87894105 missense possibly damaging 0.94
R7380:Copg1 UTSW 6 87893842 missense probably damaging 0.98
R7392:Copg1 UTSW 6 87890275 missense probably benign 0.01
R7629:Copg1 UTSW 6 87894169 missense possibly damaging 0.90
R7704:Copg1 UTSW 6 87907958 missense probably benign 0.13
R8060:Copg1 UTSW 6 87909721 missense probably damaging 0.96
R8184:Copg1 UTSW 6 87890014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCCAAGACTGCCATATTTCCC -3'
(R):5'- CGCGGAAACAAGCCGTTTAACAG -3'

Sequencing Primer
(F):5'- GCCATATTTCCCCTGCCTTAG -3'
(R):5'- AGTGTTCTGAGCGTAACACC -3'
Posted On2013-07-11