Incidental Mutation 'R7228:Rbm46'
ID562273
Institutional Source Beutler Lab
Gene Symbol Rbm46
Ensembl Gene ENSMUSG00000033882
Gene NameRNA binding motif protein 46
SynonymsENSMUSG00000033882, LOC329687
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R7228 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location82837228-82876483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82842533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 468 (D468G)
Ref Sequence ENSEMBL: ENSMUSP00000138429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048647] [ENSMUST00000182637] [ENSMUST00000182818]
Predicted Effect probably benign
Transcript: ENSMUST00000048647
SMART Domains Protein: ENSMUSP00000045511
Gene: ENSMUSG00000033882

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 9.4e-30 PFAM
low complexity region 494 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182637
SMART Domains Protein: ENSMUSP00000138728
Gene: ENSMUSG00000033882

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182818
AA Change: D468G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138429
Gene: ENSMUSG00000033882
AA Change: D468G

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 2.1e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,291,656 D66G probably damaging Het
Abca13 T A 11: 9,297,653 F2467I probably benign Het
Acod1 A G 14: 103,049,329 T23A probably benign Het
Adam2 T A 14: 66,053,912 K306* probably null Het
Adcy10 A C 1: 165,510,272 I152L probably damaging Het
Amigo1 T C 3: 108,187,230 L15P probably benign Het
Aqp2 A G 15: 99,582,124 N156S probably benign Het
AU041133 A G 10: 82,151,271 K253E possibly damaging Het
Cacna1s A G 1: 136,071,059 T231A possibly damaging Het
Carf A T 1: 60,109,394 N83I probably damaging Het
Ccdc121 T C 1: 181,510,967 K140R probably benign Het
Cdc42bpb C T 12: 111,305,093 V1111M possibly damaging Het
Cep78 A G 19: 15,969,197 S424P probably benign Het
Cfap74 G A 4: 155,465,050 V123M unknown Het
Crot T A 5: 8,976,051 N312I probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Cyp4f39 A G 17: 32,491,829 D454G probably damaging Het
Dnaja4 A T 9: 54,714,285 H298L possibly damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Eif3j2 T C 18: 43,477,509 K80E probably damaging Het
Elp4 T A 2: 105,792,302 I351F probably damaging Het
Fbxw26 C G 9: 109,724,944 G209A possibly damaging Het
Fsip2 T A 2: 82,992,307 V6128D possibly damaging Het
Gli3 A G 13: 15,724,502 T825A probably benign Het
Gm2042 A G 12: 87,957,949 E60G probably benign Het
Gm26566 G T 4: 88,722,305 R111L unknown Het
Gm3138 C A 14: 4,252,444 H147Q probably damaging Het
Gm4858 T A 3: 93,073,686 C4S possibly damaging Het
Gucy1b1 T A 3: 82,033,274 N615I unknown Het
Ighv14-1 A T 12: 113,932,361 F8I not run Het
Kcnh8 C T 17: 52,956,716 T747I probably benign Het
Kctd1 T A 18: 15,062,412 S385C possibly damaging Het
Lmo7 T A 14: 101,896,535 M672K probably damaging Het
Lrrc69 T A 4: 14,775,027 K80N probably damaging Het
Map2k5 C T 9: 63,358,022 D75N probably damaging Het
Matr3 T C 18: 35,562,484 V4A unknown Het
Megf10 T C 18: 57,189,589 C69R probably damaging Het
Mettl1 A G 10: 127,045,283 E221G probably benign Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mlh3 A T 12: 85,235,656 L1401Q probably benign Het
Nacad T C 11: 6,598,412 I1412V probably benign Het
Nkain4 A T 2: 180,954,569 probably null Het
Notch2 T A 3: 98,137,317 C1518* probably null Het
Npw A G 17: 24,658,091 V112A probably benign Het
Olfr56 T A 11: 49,134,879 M229K possibly damaging Het
Olfr713 A T 7: 107,037,100 H315L probably benign Het
Pdzd2 T C 15: 12,372,973 T2359A probably benign Het
Pdzd2 T A 15: 12,458,145 K37* probably null Het
Phkb T G 8: 85,843,007 probably benign Het
Prrc2b C A 2: 32,214,306 Y1265* probably null Het
Rab31 T A 17: 65,717,553 M44L probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Rapgef2 T C 3: 79,069,218 D1279G probably benign Het
Ryr3 T C 2: 112,861,852 E1059G probably damaging Het
Sez6l2 T C 7: 126,953,725 L221P probably damaging Het
Slit3 T A 11: 35,599,418 V361E probably damaging Het
Soat1 G A 1: 156,434,238 S400F probably damaging Het
Spp1 T C 5: 104,440,445 S238P probably damaging Het
Tfap2c T C 2: 172,551,572 S136P probably benign Het
Tgfbr2 T C 9: 116,109,943 E297G probably damaging Het
Trim2 T C 3: 84,192,181 D228G probably benign Het
Wdr82 C A 9: 106,176,672 A74E probably benign Het
Zfp451 T C 1: 33,803,394 T136A unknown Het
Other mutations in Rbm46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Rbm46 APN 3 82864416 missense possibly damaging 0.85
R0048:Rbm46 UTSW 3 82864230 missense probably damaging 0.96
R0554:Rbm46 UTSW 3 82865268 missense probably damaging 1.00
R1606:Rbm46 UTSW 3 82864541 missense probably damaging 1.00
R2200:Rbm46 UTSW 3 82864044 missense probably benign 0.00
R2357:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4646:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4647:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4648:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R5584:Rbm46 UTSW 3 82864158 missense probably benign
R5722:Rbm46 UTSW 3 82865333 missense possibly damaging 0.95
R6393:Rbm46 UTSW 3 82863955 missense probably benign 0.03
R7438:Rbm46 UTSW 3 82842488 nonsense probably null
R7445:Rbm46 UTSW 3 82864210 missense probably damaging 0.99
R7452:Rbm46 UTSW 3 82864121 missense probably benign 0.01
R8195:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8196:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8211:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8212:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8235:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8239:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8276:Rbm46 UTSW 3 82864588 missense probably damaging 0.99
Z1177:Rbm46 UTSW 3 82837318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTAGTGAAATACATGGCTTAAGC -3'
(R):5'- GCAGCATAGGATTTTCGAATACAC -3'

Sequencing Primer
(F):5'- AGCAGATAATTCTATGCATTTCCCC -3'
(R):5'- GCATAGGATTTTCGAATACACTGATG -3'
Posted On2019-06-26