Incidental Mutation 'R7228:Trim2'
ID562274
Institutional Source Beutler Lab
Gene Symbol Trim2
Ensembl Gene ENSMUSG00000027993
Gene Nametripartite motif-containing 2
Synonymsneural activity-related ring finger protein, narf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R7228 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location84160439-84306877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84192181 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 228 (D228G)
Ref Sequence ENSEMBL: ENSMUSP00000049902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054990] [ENSMUST00000065380] [ENSMUST00000107691] [ENSMUST00000107692] [ENSMUST00000107693] [ENSMUST00000107695] [ENSMUST00000122849] [ENSMUST00000132283] [ENSMUST00000147901]
Predicted Effect probably benign
Transcript: ENSMUST00000054990
AA Change: D228G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049902
Gene: ENSMUSG00000027993
AA Change: D228G

DomainStartEndE-ValueType
RING 49 89 3.5e-9 SMART
BBOX 139 180 3.52e-14 SMART
BBC 187 313 1.7e-38 SMART
IG_FLMN 350 450 2.41e-30 SMART
Pfam:NHL 512 539 2e-8 PFAM
Pfam:NHL 559 586 1.1e-8 PFAM
Pfam:NHL 601 628 2.1e-7 PFAM
Pfam:NHL 648 675 5.8e-10 PFAM
Pfam:NHL 695 722 3.5e-12 PFAM
Pfam:NHL 739 766 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065380
AA Change: D202G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069922
Gene: ENSMUSG00000027993
AA Change: D202G

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107691
AA Change: D202G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103319
Gene: ENSMUSG00000027993
AA Change: D202G

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107692
AA Change: D202G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103320
Gene: ENSMUSG00000027993
AA Change: D202G

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107693
AA Change: D202G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103321
Gene: ENSMUSG00000027993
AA Change: D202G

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107695
AA Change: D219G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103323
Gene: ENSMUSG00000027993
AA Change: D219G

DomainStartEndE-ValueType
RING 40 80 3.5e-9 SMART
BBOX 130 171 3.52e-14 SMART
BBC 178 304 1.7e-38 SMART
IG_FLMN 341 441 2.41e-30 SMART
Pfam:NHL 503 530 9.1e-8 PFAM
Pfam:NHL 550 577 7.5e-8 PFAM
Pfam:NHL 592 619 1.2e-6 PFAM
Pfam:NHL 639 666 6.3e-9 PFAM
Pfam:NHL 686 713 4.7e-12 PFAM
Pfam:NHL 730 757 5.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122849
SMART Domains Protein: ENSMUSP00000120981
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 41 81 3.5e-9 SMART
BBOX 131 172 3.52e-14 SMART
Blast:BBC 179 213 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132283
SMART Domains Protein: ENSMUSP00000118888
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
Blast:BBC 161 191 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147901
SMART Domains Protein: ENSMUSP00000121055
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit tremors, ataxia and seizures associated with neurodegeneration of Purkinje cells, deep cerebellar nuclei and retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,291,656 D66G probably damaging Het
Abca13 T A 11: 9,297,653 F2467I probably benign Het
Acod1 A G 14: 103,049,329 T23A probably benign Het
Adam2 T A 14: 66,053,912 K306* probably null Het
Adcy10 A C 1: 165,510,272 I152L probably damaging Het
Amigo1 T C 3: 108,187,230 L15P probably benign Het
Aqp2 A G 15: 99,582,124 N156S probably benign Het
AU041133 A G 10: 82,151,271 K253E possibly damaging Het
Cacna1s A G 1: 136,071,059 T231A possibly damaging Het
Carf A T 1: 60,109,394 N83I probably damaging Het
Ccdc121 T C 1: 181,510,967 K140R probably benign Het
Cdc42bpb C T 12: 111,305,093 V1111M possibly damaging Het
Cep78 A G 19: 15,969,197 S424P probably benign Het
Cfap74 G A 4: 155,465,050 V123M unknown Het
Crot T A 5: 8,976,051 N312I probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Cyp4f39 A G 17: 32,491,829 D454G probably damaging Het
Dnaja4 A T 9: 54,714,285 H298L possibly damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Eif3j2 T C 18: 43,477,509 K80E probably damaging Het
Elp4 T A 2: 105,792,302 I351F probably damaging Het
Fbxw26 C G 9: 109,724,944 G209A possibly damaging Het
Fsip2 T A 2: 82,992,307 V6128D possibly damaging Het
Gli3 A G 13: 15,724,502 T825A probably benign Het
Gm2042 A G 12: 87,957,949 E60G probably benign Het
Gm26566 G T 4: 88,722,305 R111L unknown Het
Gm3138 C A 14: 4,252,444 H147Q probably damaging Het
Gm4858 T A 3: 93,073,686 C4S possibly damaging Het
Gucy1b1 T A 3: 82,033,274 N615I unknown Het
Ighv14-1 A T 12: 113,932,361 F8I not run Het
Kcnh8 C T 17: 52,956,716 T747I probably benign Het
Kctd1 T A 18: 15,062,412 S385C possibly damaging Het
Lmo7 T A 14: 101,896,535 M672K probably damaging Het
Lrrc69 T A 4: 14,775,027 K80N probably damaging Het
Map2k5 C T 9: 63,358,022 D75N probably damaging Het
Matr3 T C 18: 35,562,484 V4A unknown Het
Megf10 T C 18: 57,189,589 C69R probably damaging Het
Mettl1 A G 10: 127,045,283 E221G probably benign Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mlh3 A T 12: 85,235,656 L1401Q probably benign Het
Nacad T C 11: 6,598,412 I1412V probably benign Het
Nkain4 A T 2: 180,954,569 probably null Het
Notch2 T A 3: 98,137,317 C1518* probably null Het
Npw A G 17: 24,658,091 V112A probably benign Het
Olfr56 T A 11: 49,134,879 M229K possibly damaging Het
Olfr713 A T 7: 107,037,100 H315L probably benign Het
Pdzd2 T C 15: 12,372,973 T2359A probably benign Het
Pdzd2 T A 15: 12,458,145 K37* probably null Het
Phkb T G 8: 85,843,007 probably benign Het
Prrc2b C A 2: 32,214,306 Y1265* probably null Het
Rab31 T A 17: 65,717,553 M44L probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Rapgef2 T C 3: 79,069,218 D1279G probably benign Het
Rbm46 T C 3: 82,842,533 D468G probably benign Het
Ryr3 T C 2: 112,861,852 E1059G probably damaging Het
Sez6l2 T C 7: 126,953,725 L221P probably damaging Het
Slit3 T A 11: 35,599,418 V361E probably damaging Het
Soat1 G A 1: 156,434,238 S400F probably damaging Het
Spp1 T C 5: 104,440,445 S238P probably damaging Het
Tfap2c T C 2: 172,551,572 S136P probably benign Het
Tgfbr2 T C 9: 116,109,943 E297G probably damaging Het
Wdr82 C A 9: 106,176,672 A74E probably benign Het
Zfp451 T C 1: 33,803,394 T136A unknown Het
Other mutations in Trim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trim2 APN 3 84208289 missense probably damaging 1.00
IGL01658:Trim2 APN 3 84210285 missense probably benign 0.33
IGL02943:Trim2 APN 3 84178176 missense probably benign 0.45
PIT4142001:Trim2 UTSW 3 84190857 missense probably benign 0.00
R0149:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R0158:Trim2 UTSW 3 84210169 splice site probably benign
R0361:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R1270:Trim2 UTSW 3 84167677 missense probably damaging 1.00
R1651:Trim2 UTSW 3 84167650 critical splice donor site probably null
R1756:Trim2 UTSW 3 84190800 missense possibly damaging 0.52
R1938:Trim2 UTSW 3 84177792 missense possibly damaging 0.94
R2046:Trim2 UTSW 3 84208289 missense probably damaging 1.00
R2192:Trim2 UTSW 3 84190918 nonsense probably null
R3696:Trim2 UTSW 3 84190851 missense probably benign 0.05
R4981:Trim2 UTSW 3 84177735 missense probably damaging 1.00
R5389:Trim2 UTSW 3 84167653 missense probably null 0.60
R5735:Trim2 UTSW 3 84167722 missense probably damaging 1.00
R7297:Trim2 UTSW 3 84210233 missense probably damaging 1.00
R7640:Trim2 UTSW 3 84190906 missense probably benign 0.07
R7853:Trim2 UTSW 3 84305230 splice site probably benign
R7993:Trim2 UTSW 3 84190719 missense probably damaging 1.00
R8205:Trim2 UTSW 3 84193339 missense probably damaging 1.00
R8516:Trim2 UTSW 3 84208320 missense probably damaging 1.00
X0065:Trim2 UTSW 3 84165173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCACTGTTAGAACGCAGTAAG -3'
(R):5'- TTTTAAAGGTGATGCAAGCAGC -3'

Sequencing Primer
(F):5'- CTGTTAGAACGCAGTAAGCAGGC -3'
(R):5'- CAGCATAGTAAAAAGCGCTTGC -3'
Posted On2019-06-26