Incidental Mutation 'R0576:Ccdc77'
ID56228
Institutional Source Beutler Lab
Gene Symbol Ccdc77
Ensembl Gene ENSMUSG00000030177
Gene Namecoiled-coil domain containing 77
Synonyms2700091N06Rik, 2400002C23Rik
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0576 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120324323-120364374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120331848 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 335 (L335F)
Ref Sequence ENSEMBL: ENSMUSP00000032283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032283] [ENSMUST00000112703] [ENSMUST00000127146] [ENSMUST00000136829] [ENSMUST00000144131] [ENSMUST00000163827]
Predicted Effect probably benign
Transcript: ENSMUST00000032283
AA Change: L335F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032283
Gene: ENSMUSG00000030177
AA Change: L335F

DomainStartEndE-ValueType
coiled coil region 57 120 N/A INTRINSIC
low complexity region 221 235 N/A INTRINSIC
coiled coil region 346 380 N/A INTRINSIC
coiled coil region 414 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112703
AA Change: L317F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108323
Gene: ENSMUSG00000030177
AA Change: L317F

DomainStartEndE-ValueType
coiled coil region 39 102 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
internal_repeat_1 258 283 9.62e-5 PROSPERO
internal_repeat_1 321 348 9.62e-5 PROSPERO
low complexity region 352 369 N/A INTRINSIC
coiled coil region 396 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127146
SMART Domains Protein: ENSMUSP00000120896
Gene: ENSMUSG00000030177

DomainStartEndE-ValueType
coiled coil region 39 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136829
SMART Domains Protein: ENSMUSP00000126554
Gene: ENSMUSG00000030177

DomainStartEndE-ValueType
coiled coil region 57 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144131
SMART Domains Protein: ENSMUSP00000127096
Gene: ENSMUSG00000030177

DomainStartEndE-ValueType
coiled coil region 39 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163827
SMART Domains Protein: ENSMUSP00000131970
Gene: ENSMUSG00000030177

DomainStartEndE-ValueType
coiled coil region 39 102 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Ccdc77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ccdc77 APN 6 120329084 unclassified probably benign
IGL01323:Ccdc77 APN 6 120334796 missense probably benign 0.25
IGL02086:Ccdc77 APN 6 120339158 missense possibly damaging 0.89
IGL02388:Ccdc77 APN 6 120331897 missense probably benign
R1485:Ccdc77 UTSW 6 120338140 nonsense probably null
R2422:Ccdc77 UTSW 6 120339159 missense probably benign 0.01
R2497:Ccdc77 UTSW 6 120325472 missense possibly damaging 0.62
R4906:Ccdc77 UTSW 6 120334835 missense probably damaging 0.98
R5104:Ccdc77 UTSW 6 120348385 splice site probably null
R6467:Ccdc77 UTSW 6 120350281 missense probably damaging 0.99
R7165:Ccdc77 UTSW 6 120350232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGAGTctctgacaggctctc -3'
(R):5'- CATCCTCTTTGGAATGGCCCTGTG -3'

Sequencing Primer
(F):5'- acaggctctccaactcaac -3'
(R):5'- AATGGCCCTGTGATTGAGC -3'
Posted On2013-07-11