Incidental Mutation 'R7228:Dnaja4'
ID562289
Institutional Source Beutler Lab
Gene Symbol Dnaja4
Ensembl Gene ENSMUSG00000032285
Gene NameDnaJ heat shock protein family (Hsp40) member A4
Synonyms1110021L12Rik, Hsj4, Dj4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7228 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location54698873-54716315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54714285 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 298 (H298L)
Ref Sequence ENSEMBL: ENSMUSP00000070413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051822] [ENSMUST00000070070] [ENSMUST00000118771] [ENSMUST00000120452] [ENSMUST00000121204] [ENSMUST00000130368] [ENSMUST00000154690]
Predicted Effect probably benign
Transcript: ENSMUST00000051822
SMART Domains Protein: ENSMUSP00000056359
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
WD40 263 302 1.49e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070070
AA Change: H298L

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070413
Gene: ENSMUSG00000032285
AA Change: H298L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 2.1e-15 PFAM
Pfam:CTDII 258 340 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118771
SMART Domains Protein: ENSMUSP00000112811
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120452
AA Change: H298L

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112520
Gene: ENSMUSG00000032285
AA Change: H298L

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_C 108 330 9.7e-35 PFAM
Pfam:DnaJ_CXXCXGXG 135 201 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121204
SMART Domains Protein: ENSMUSP00000113560
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
WD40 263 302 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130368
SMART Domains Protein: ENSMUSP00000123077
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 5 36 5.3e1 SMART
WD40 39 78 7.73e-6 SMART
WD40 81 120 3.21e-12 SMART
WD40 123 162 8.81e-10 SMART
WD40 165 204 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154690
SMART Domains Protein: ENSMUSP00000119602
Gene: ENSMUSG00000032285

DomainStartEndE-ValueType
DnaJ 5 60 1.41e-31 SMART
low complexity region 75 85 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:DnaJ_CXXCXGXG 135 201 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,291,656 D66G probably damaging Het
Abca13 T A 11: 9,297,653 F2467I probably benign Het
Acod1 A G 14: 103,049,329 T23A probably benign Het
Adam2 T A 14: 66,053,912 K306* probably null Het
Adcy10 A C 1: 165,510,272 I152L probably damaging Het
Amigo1 T C 3: 108,187,230 L15P probably benign Het
Aqp2 A G 15: 99,582,124 N156S probably benign Het
AU041133 A G 10: 82,151,271 K253E possibly damaging Het
Cacna1s A G 1: 136,071,059 T231A possibly damaging Het
Carf A T 1: 60,109,394 N83I probably damaging Het
Ccdc121 T C 1: 181,510,967 K140R probably benign Het
Cdc42bpb C T 12: 111,305,093 V1111M possibly damaging Het
Cep78 A G 19: 15,969,197 S424P probably benign Het
Cfap74 G A 4: 155,465,050 V123M unknown Het
Crot T A 5: 8,976,051 N312I probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Cyp4f39 A G 17: 32,491,829 D454G probably damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Eif3j2 T C 18: 43,477,509 K80E probably damaging Het
Elp4 T A 2: 105,792,302 I351F probably damaging Het
Fbxw26 C G 9: 109,724,944 G209A possibly damaging Het
Fsip2 T A 2: 82,992,307 V6128D possibly damaging Het
Gli3 A G 13: 15,724,502 T825A probably benign Het
Gm2042 A G 12: 87,957,949 E60G probably benign Het
Gm26566 G T 4: 88,722,305 R111L unknown Het
Gm3138 C A 14: 4,252,444 H147Q probably damaging Het
Gm4858 T A 3: 93,073,686 C4S possibly damaging Het
Gucy1b1 T A 3: 82,033,274 N615I unknown Het
Ighv14-1 A T 12: 113,932,361 F8I not run Het
Kcnh8 C T 17: 52,956,716 T747I probably benign Het
Kctd1 T A 18: 15,062,412 S385C possibly damaging Het
Lmo7 T A 14: 101,896,535 M672K probably damaging Het
Lrrc69 T A 4: 14,775,027 K80N probably damaging Het
Map2k5 C T 9: 63,358,022 D75N probably damaging Het
Matr3 T C 18: 35,562,484 V4A unknown Het
Megf10 T C 18: 57,189,589 C69R probably damaging Het
Mettl1 A G 10: 127,045,283 E221G probably benign Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mlh3 A T 12: 85,235,656 L1401Q probably benign Het
Nacad T C 11: 6,598,412 I1412V probably benign Het
Nkain4 A T 2: 180,954,569 probably null Het
Notch2 T A 3: 98,137,317 C1518* probably null Het
Npw A G 17: 24,658,091 V112A probably benign Het
Olfr56 T A 11: 49,134,879 M229K possibly damaging Het
Olfr713 A T 7: 107,037,100 H315L probably benign Het
Pdzd2 T C 15: 12,372,973 T2359A probably benign Het
Pdzd2 T A 15: 12,458,145 K37* probably null Het
Phkb T G 8: 85,843,007 probably benign Het
Prrc2b C A 2: 32,214,306 Y1265* probably null Het
Rab31 T A 17: 65,717,553 M44L probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Rapgef2 T C 3: 79,069,218 D1279G probably benign Het
Rbm46 T C 3: 82,842,533 D468G probably benign Het
Ryr3 T C 2: 112,861,852 E1059G probably damaging Het
Sez6l2 T C 7: 126,953,725 L221P probably damaging Het
Slit3 T A 11: 35,599,418 V361E probably damaging Het
Soat1 G A 1: 156,434,238 S400F probably damaging Het
Spp1 T C 5: 104,440,445 S238P probably damaging Het
Tfap2c T C 2: 172,551,572 S136P probably benign Het
Tgfbr2 T C 9: 116,109,943 E297G probably damaging Het
Trim2 T C 3: 84,192,181 D228G probably benign Het
Wdr82 C A 9: 106,176,672 A74E probably benign Het
Zfp451 T C 1: 33,803,394 T136A unknown Het
Other mutations in Dnaja4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Dnaja4 APN 9 54714510 missense possibly damaging 0.93
PIT4305001:Dnaja4 UTSW 9 54710634 missense probably benign 0.01
R2139:Dnaja4 UTSW 9 54709222 missense probably benign 0.01
R4837:Dnaja4 UTSW 9 54710644 missense probably benign 0.00
R5087:Dnaja4 UTSW 9 54699739 missense probably damaging 0.99
R5862:Dnaja4 UTSW 9 54699341 unclassified probably benign
R6722:Dnaja4 UTSW 9 54699754 missense probably damaging 0.99
R6985:Dnaja4 UTSW 9 54708395 missense probably benign 0.06
R7165:Dnaja4 UTSW 9 54709232 missense probably damaging 1.00
R7762:Dnaja4 UTSW 9 54709210 missense probably benign 0.03
X0057:Dnaja4 UTSW 9 54699804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGTCTCAGTGTGCTTG -3'
(R):5'- TTTTCAGGGAAGACTACCTGC -3'

Sequencing Primer
(F):5'- CTTCCTGATGTGGGCCAG -3'
(R):5'- CTACCTGCAGAGGAGAGCAC -3'
Posted On2019-06-26