Incidental Mutation 'R7228:Map2k5'
ID562290
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7228 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63358022 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 75 (D75N)
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure
Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034920
AA Change: D75N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: D75N

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,291,656 D66G probably damaging Het
Abca13 T A 11: 9,297,653 F2467I probably benign Het
Acod1 A G 14: 103,049,329 T23A probably benign Het
Adam2 T A 14: 66,053,912 K306* probably null Het
Adcy10 A C 1: 165,510,272 I152L probably damaging Het
Amigo1 T C 3: 108,187,230 L15P probably benign Het
Aqp2 A G 15: 99,582,124 N156S probably benign Het
AU041133 A G 10: 82,151,271 K253E possibly damaging Het
Cacna1s A G 1: 136,071,059 T231A possibly damaging Het
Carf A T 1: 60,109,394 N83I probably damaging Het
Ccdc121 T C 1: 181,510,967 K140R probably benign Het
Cdc42bpb C T 12: 111,305,093 V1111M possibly damaging Het
Cep78 A G 19: 15,969,197 S424P probably benign Het
Cfap74 G A 4: 155,465,050 V123M unknown Het
Crot T A 5: 8,976,051 N312I probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Cyp4f39 A G 17: 32,491,829 D454G probably damaging Het
Dnaja4 A T 9: 54,714,285 H298L possibly damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Eif3j2 T C 18: 43,477,509 K80E probably damaging Het
Elp4 T A 2: 105,792,302 I351F probably damaging Het
Fbxw26 C G 9: 109,724,944 G209A possibly damaging Het
Fsip2 T A 2: 82,992,307 V6128D possibly damaging Het
Gli3 A G 13: 15,724,502 T825A probably benign Het
Gm2042 A G 12: 87,957,949 E60G probably benign Het
Gm26566 G T 4: 88,722,305 R111L unknown Het
Gm3138 C A 14: 4,252,444 H147Q probably damaging Het
Gm4858 T A 3: 93,073,686 C4S possibly damaging Het
Gucy1b1 T A 3: 82,033,274 N615I unknown Het
Ighv14-1 A T 12: 113,932,361 F8I not run Het
Kcnh8 C T 17: 52,956,716 T747I probably benign Het
Kctd1 T A 18: 15,062,412 S385C possibly damaging Het
Lmo7 T A 14: 101,896,535 M672K probably damaging Het
Lrrc69 T A 4: 14,775,027 K80N probably damaging Het
Matr3 T C 18: 35,562,484 V4A unknown Het
Megf10 T C 18: 57,189,589 C69R probably damaging Het
Mettl1 A G 10: 127,045,283 E221G probably benign Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mlh3 A T 12: 85,235,656 L1401Q probably benign Het
Nacad T C 11: 6,598,412 I1412V probably benign Het
Nkain4 A T 2: 180,954,569 probably null Het
Notch2 T A 3: 98,137,317 C1518* probably null Het
Npw A G 17: 24,658,091 V112A probably benign Het
Olfr56 T A 11: 49,134,879 M229K possibly damaging Het
Olfr713 A T 7: 107,037,100 H315L probably benign Het
Pdzd2 T C 15: 12,372,973 T2359A probably benign Het
Pdzd2 T A 15: 12,458,145 K37* probably null Het
Phkb T G 8: 85,843,007 probably benign Het
Prrc2b C A 2: 32,214,306 Y1265* probably null Het
Rab31 T A 17: 65,717,553 M44L probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Rapgef2 T C 3: 79,069,218 D1279G probably benign Het
Rbm46 T C 3: 82,842,533 D468G probably benign Het
Ryr3 T C 2: 112,861,852 E1059G probably damaging Het
Sez6l2 T C 7: 126,953,725 L221P probably damaging Het
Slit3 T A 11: 35,599,418 V361E probably damaging Het
Soat1 G A 1: 156,434,238 S400F probably damaging Het
Spp1 T C 5: 104,440,445 S238P probably damaging Het
Tfap2c T C 2: 172,551,572 S136P probably benign Het
Tgfbr2 T C 9: 116,109,943 E297G probably damaging Het
Trim2 T C 3: 84,192,181 D228G probably benign Het
Wdr82 C A 9: 106,176,672 A74E probably benign Het
Zfp451 T C 1: 33,803,394 T136A unknown Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGCCCAAGAAACAGCATC -3'
(R):5'- TGGATGGTAACCGTGTGCAC -3'

Sequencing Primer
(F):5'- CACAACTCACATGGTGGCAGG -3'
(R):5'- CGAGTCTTACTGCTTTCATC -3'
Posted On2019-06-26