Incidental Mutation 'R0576:Otud7a'
ID56231
Institutional Source Beutler Lab
Gene Symbol Otud7a
Ensembl Gene ENSMUSG00000033510
Gene NameOTU domain containing 7A
SynonymsCezanne 2 protein, Otud7
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0576 (G1)
Quality Score172
Status Validated
Chromosome7
Chromosomal Location63444751-63759028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63685518 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 101 (P101S)
Ref Sequence ENSEMBL: ENSMUSP00000057282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058476] [ENSMUST00000177534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058476
AA Change: P101S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057282
Gene: ENSMUSG00000033510
AA Change: P101S

DomainStartEndE-ValueType
PDB:2L2D|A 11 82 4e-43 PDB
Pfam:OTU 207 371 1.5e-26 PFAM
low complexity region 478 510 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 559 581 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 730 777 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 865 872 N/A INTRINSIC
Pfam:zf-A20 888 912 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177534
AA Change: P101S

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135559
Gene: ENSMUSG00000033510
AA Change: P101S

DomainStartEndE-ValueType
Pfam:UBA_4 28 66 2e-7 PFAM
Pfam:OTU 206 377 5.7e-32 PFAM
low complexity region 484 516 N/A INTRINSIC
low complexity region 533 553 N/A INTRINSIC
low complexity region 565 587 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
Meta Mutation Damage Score 0.1981 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinizing enzyme and possible tumor suppressor. The encoded protein acts on TNF receptor associated factor 6 (TRAF6) to control nuclear factor kappa B expression. However, this gene is downregulated by SNAIL1 in hepatocellular carcinoma cells, contributing to their progression and malignancy. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, abnormal spike wave discharge, decreased dendritic spine density, decreased prepulse inhibition, impaired coordination, decreased grip strength, decreased startle reflex, impaired ultrasonic vocalization and delayed tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Otud7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:Otud7a UTSW 7 63735801 missense probably benign 0.32
R0241:Otud7a UTSW 7 63697244 splice site probably benign
R0594:Otud7a UTSW 7 63727472 nonsense probably null
R0611:Otud7a UTSW 7 63735890 missense possibly damaging 0.84
R1473:Otud7a UTSW 7 63754629 splice site probably benign
R1519:Otud7a UTSW 7 63758643 missense probably damaging 1.00
R1694:Otud7a UTSW 7 63733710 missense probably damaging 1.00
R1941:Otud7a UTSW 7 63729826 nonsense probably null
R1952:Otud7a UTSW 7 63650876 missense probably damaging 0.96
R2199:Otud7a UTSW 7 63757656 missense possibly damaging 0.53
R2404:Otud7a UTSW 7 63697151 missense probably benign 0.20
R4238:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4239:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4294:Otud7a UTSW 7 63697191 missense probably damaging 0.99
R4512:Otud7a UTSW 7 63729877 missense probably benign 0.32
R4748:Otud7a UTSW 7 63735915 missense possibly damaging 0.73
R4815:Otud7a UTSW 7 63729910 critical splice donor site probably null
R4942:Otud7a UTSW 7 63757423 missense probably damaging 0.99
R5249:Otud7a UTSW 7 63757433 missense possibly damaging 0.53
R5332:Otud7a UTSW 7 63735826 missense probably damaging 0.98
R5438:Otud7a UTSW 7 63757459 missense unknown
R6185:Otud7a UTSW 7 63758385 missense probably damaging 0.99
R7099:Otud7a UTSW 7 63757455 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCTCATTAACATGCTGACTGGCAC -3'
(R):5'- CTGGAGAAGATGCCTGTCACGAAAG -3'

Sequencing Primer
(F):5'- CACATTTTCTCCAGGAAAGCTAGG -3'
(R):5'- CCAATAGGTTACTGGCCTCTAAAGG -3'
Posted On2013-07-11