Incidental Mutation 'R7228:Rab31'
ID562315
Institutional Source Beutler Lab
Gene Symbol Rab31
Ensembl Gene ENSMUSG00000056515
Gene NameRAB31, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7228 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location65651726-65772752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65717553 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 44 (M44L)
Ref Sequence ENSEMBL: ENSMUSP00000068195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070673]
Predicted Effect probably benign
Transcript: ENSMUST00000070673
AA Change: M44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068195
Gene: ENSMUSG00000056515
AA Change: M44L

DomainStartEndE-ValueType
RAB 7 170 9.87e-69 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small GTP-binding proteins of the RAB family, such as RAB31, play essential roles in vesicle and granule targeting (Bao et al., 2002 [PubMed 11784320]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,291,656 D66G probably damaging Het
Abca13 T A 11: 9,297,653 F2467I probably benign Het
Acod1 A G 14: 103,049,329 T23A probably benign Het
Adam2 T A 14: 66,053,912 K306* probably null Het
Adcy10 A C 1: 165,510,272 I152L probably damaging Het
Amigo1 T C 3: 108,187,230 L15P probably benign Het
Aqp2 A G 15: 99,582,124 N156S probably benign Het
AU041133 A G 10: 82,151,271 K253E possibly damaging Het
Cacna1s A G 1: 136,071,059 T231A possibly damaging Het
Carf A T 1: 60,109,394 N83I probably damaging Het
Ccdc121 T C 1: 181,510,967 K140R probably benign Het
Cdc42bpb C T 12: 111,305,093 V1111M possibly damaging Het
Cep78 A G 19: 15,969,197 S424P probably benign Het
Cfap74 G A 4: 155,465,050 V123M unknown Het
Crot T A 5: 8,976,051 N312I probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Cyp4f39 A G 17: 32,491,829 D454G probably damaging Het
Dnaja4 A T 9: 54,714,285 H298L possibly damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Eif3j2 T C 18: 43,477,509 K80E probably damaging Het
Elp4 T A 2: 105,792,302 I351F probably damaging Het
Fbxw26 C G 9: 109,724,944 G209A possibly damaging Het
Fsip2 T A 2: 82,992,307 V6128D possibly damaging Het
Gli3 A G 13: 15,724,502 T825A probably benign Het
Gm2042 A G 12: 87,957,949 E60G probably benign Het
Gm26566 G T 4: 88,722,305 R111L unknown Het
Gm3138 C A 14: 4,252,444 H147Q probably damaging Het
Gm4858 T A 3: 93,073,686 C4S possibly damaging Het
Gucy1b1 T A 3: 82,033,274 N615I unknown Het
Ighv14-1 A T 12: 113,932,361 F8I not run Het
Kcnh8 C T 17: 52,956,716 T747I probably benign Het
Kctd1 T A 18: 15,062,412 S385C possibly damaging Het
Lmo7 T A 14: 101,896,535 M672K probably damaging Het
Lrrc69 T A 4: 14,775,027 K80N probably damaging Het
Map2k5 C T 9: 63,358,022 D75N probably damaging Het
Matr3 T C 18: 35,562,484 V4A unknown Het
Megf10 T C 18: 57,189,589 C69R probably damaging Het
Mettl1 A G 10: 127,045,283 E221G probably benign Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mlh3 A T 12: 85,235,656 L1401Q probably benign Het
Nacad T C 11: 6,598,412 I1412V probably benign Het
Nkain4 A T 2: 180,954,569 probably null Het
Notch2 T A 3: 98,137,317 C1518* probably null Het
Npw A G 17: 24,658,091 V112A probably benign Het
Olfr56 T A 11: 49,134,879 M229K possibly damaging Het
Olfr713 A T 7: 107,037,100 H315L probably benign Het
Pdzd2 T C 15: 12,372,973 T2359A probably benign Het
Pdzd2 T A 15: 12,458,145 K37* probably null Het
Phkb T G 8: 85,843,007 probably benign Het
Prrc2b C A 2: 32,214,306 Y1265* probably null Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Rapgef2 T C 3: 79,069,218 D1279G probably benign Het
Rbm46 T C 3: 82,842,533 D468G probably benign Het
Ryr3 T C 2: 112,861,852 E1059G probably damaging Het
Sez6l2 T C 7: 126,953,725 L221P probably damaging Het
Slit3 T A 11: 35,599,418 V361E probably damaging Het
Soat1 G A 1: 156,434,238 S400F probably damaging Het
Spp1 T C 5: 104,440,445 S238P probably damaging Het
Tfap2c T C 2: 172,551,572 S136P probably benign Het
Tgfbr2 T C 9: 116,109,943 E297G probably damaging Het
Trim2 T C 3: 84,192,181 D228G probably benign Het
Wdr82 C A 9: 106,176,672 A74E probably benign Het
Zfp451 T C 1: 33,803,394 T136A unknown Het
Other mutations in Rab31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Rab31 APN 17 65722003 splice site probably null
IGL02493:Rab31 APN 17 65717552 missense possibly damaging 0.83
IGL03395:Rab31 APN 17 65696367 missense probably benign 0.02
R1967:Rab31 UTSW 17 65772504 critical splice donor site probably null
R4343:Rab31 UTSW 17 65654419 missense probably benign 0.00
R4810:Rab31 UTSW 17 65722003 splice site probably null
R7090:Rab31 UTSW 17 65698017 missense possibly damaging 0.92
R8056:Rab31 UTSW 17 65717508 missense probably benign 0.33
R8202:Rab31 UTSW 17 65667886 missense probably damaging 1.00
R8330:Rab31 UTSW 17 65696274 missense possibly damaging 0.94
R8708:Rab31 UTSW 17 65667864 critical splice donor site probably benign
R8796:Rab31 UTSW 17 65772534 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACCTAGCAGTTGTTTTCAGATGG -3'
(R):5'- TCGTTTTGAAACTTCAGCTGG -3'

Sequencing Primer
(F):5'- GGTGAAATAAACCTTTCATGTGTGTG -3'
(R):5'- GACAAGGGTTCTTAGGGT -3'
Posted On2019-06-26