Incidental Mutation 'R7228:Kctd1'
ID562316
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Namepotassium channel tetramerisation domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7228 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location14968685-15151446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15062412 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 385 (S385C)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
Predicted Effect probably benign
Transcript: ENSMUST00000025992
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168989
AA Change: S385C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: S385C

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T C 9: 51,291,656 D66G probably damaging Het
Abca13 T A 11: 9,297,653 F2467I probably benign Het
Acod1 A G 14: 103,049,329 T23A probably benign Het
Adam2 T A 14: 66,053,912 K306* probably null Het
Adcy10 A C 1: 165,510,272 I152L probably damaging Het
Amigo1 T C 3: 108,187,230 L15P probably benign Het
Aqp2 A G 15: 99,582,124 N156S probably benign Het
AU041133 A G 10: 82,151,271 K253E possibly damaging Het
Cacna1s A G 1: 136,071,059 T231A possibly damaging Het
Carf A T 1: 60,109,394 N83I probably damaging Het
Ccdc121 T C 1: 181,510,967 K140R probably benign Het
Cdc42bpb C T 12: 111,305,093 V1111M possibly damaging Het
Cep78 A G 19: 15,969,197 S424P probably benign Het
Cfap74 G A 4: 155,465,050 V123M unknown Het
Crot T A 5: 8,976,051 N312I probably damaging Het
Cyp2c69 C A 19: 39,881,166 M136I possibly damaging Het
Cyp4f39 A G 17: 32,491,829 D454G probably damaging Het
Dnaja4 A T 9: 54,714,285 H298L possibly damaging Het
Eif2ak4 C T 2: 118,457,157 T1081M probably damaging Het
Eif3j2 T C 18: 43,477,509 K80E probably damaging Het
Elp4 T A 2: 105,792,302 I351F probably damaging Het
Fbxw26 C G 9: 109,724,944 G209A possibly damaging Het
Fsip2 T A 2: 82,992,307 V6128D possibly damaging Het
Gli3 A G 13: 15,724,502 T825A probably benign Het
Gm2042 A G 12: 87,957,949 E60G probably benign Het
Gm26566 G T 4: 88,722,305 R111L unknown Het
Gm3138 C A 14: 4,252,444 H147Q probably damaging Het
Gm4858 T A 3: 93,073,686 C4S possibly damaging Het
Gucy1b1 T A 3: 82,033,274 N615I unknown Het
Ighv14-1 A T 12: 113,932,361 F8I not run Het
Kcnh8 C T 17: 52,956,716 T747I probably benign Het
Lmo7 T A 14: 101,896,535 M672K probably damaging Het
Lrrc69 T A 4: 14,775,027 K80N probably damaging Het
Map2k5 C T 9: 63,358,022 D75N probably damaging Het
Matr3 T C 18: 35,562,484 V4A unknown Het
Megf10 T C 18: 57,189,589 C69R probably damaging Het
Mettl1 A G 10: 127,045,283 E221G probably benign Het
Mkrn3 C A 7: 62,419,667 R125S probably benign Het
Mlh3 A T 12: 85,235,656 L1401Q probably benign Het
Nacad T C 11: 6,598,412 I1412V probably benign Het
Nkain4 A T 2: 180,954,569 probably null Het
Notch2 T A 3: 98,137,317 C1518* probably null Het
Npw A G 17: 24,658,091 V112A probably benign Het
Olfr56 T A 11: 49,134,879 M229K possibly damaging Het
Olfr713 A T 7: 107,037,100 H315L probably benign Het
Pdzd2 T C 15: 12,372,973 T2359A probably benign Het
Pdzd2 T A 15: 12,458,145 K37* probably null Het
Phkb T G 8: 85,843,007 probably benign Het
Prrc2b C A 2: 32,214,306 Y1265* probably null Het
Rab31 T A 17: 65,717,553 M44L probably benign Het
Rap1gds1 C T 3: 138,957,467 G373R probably damaging Het
Rapgef2 T C 3: 79,069,218 D1279G probably benign Het
Rbm46 T C 3: 82,842,533 D468G probably benign Het
Ryr3 T C 2: 112,861,852 E1059G probably damaging Het
Sez6l2 T C 7: 126,953,725 L221P probably damaging Het
Slit3 T A 11: 35,599,418 V361E probably damaging Het
Soat1 G A 1: 156,434,238 S400F probably damaging Het
Spp1 T C 5: 104,440,445 S238P probably damaging Het
Tfap2c T C 2: 172,551,572 S136P probably benign Het
Tgfbr2 T C 9: 116,109,943 E297G probably damaging Het
Trim2 T C 3: 84,192,181 D228G probably benign Het
Wdr82 C A 9: 106,176,672 A74E probably benign Het
Zfp451 T C 1: 33,803,394 T136A unknown Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15062690 missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01404:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15062637 missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15062880 missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 14969610 missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 14973979 critical splice donor site probably null
R0128:Kctd1 UTSW 18 14974180 missense probably benign 0.00
R0598:Kctd1 UTSW 18 15007765 missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15062597 missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15062460 missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 14969560 missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15063206 intron probably benign
R1779:Kctd1 UTSW 18 15061782 missense probably benign 0.01
R2083:Kctd1 UTSW 18 14974055 missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15062211 missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 14974086 missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15007700 missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15063227 intron probably benign
R4884:Kctd1 UTSW 18 14974254 missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15062523 missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15062765 missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15062265 missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15063516 intron probably benign
R5893:Kctd1 UTSW 18 14969688 missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 14969631 nonsense probably null
R6767:Kctd1 UTSW 18 15062175 missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 14986344 missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 14973988 missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15062643 missense possibly damaging 0.71
R7688:Kctd1 UTSW 18 14974198 missense probably benign 0.03
Z1176:Kctd1 UTSW 18 15063125 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGGTCTTGGACAGCTTGGC -3'
(R):5'- GAGACGTGCATGTACTTCTGCAC -3'

Sequencing Primer
(F):5'- CTGCCTTGGACAGCATCTG -3'
(R):5'- ATGTACTTCTGCACGCGAG -3'
Posted On2019-06-26