Incidental Mutation 'R7229:Chrng'
ID 562322
Institutional Source Beutler Lab
Gene Symbol Chrng
Ensembl Gene ENSMUSG00000026253
Gene Name cholinergic receptor, nicotinic, gamma polypeptide
Synonyms Acrg, Achr-3
MMRRC Submission 045301-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7229 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 87133533-87139365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87137166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 275 (T275S)
Ref Sequence ENSEMBL: ENSMUSP00000027470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027470] [ENSMUST00000050876] [ENSMUST00000076362] [ENSMUST00000113230] [ENSMUST00000113231] [ENSMUST00000113232] [ENSMUST00000113233] [ENSMUST00000113235] [ENSMUST00000123735] [ENSMUST00000185763] [ENSMUST00000186038] [ENSMUST00000188796]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027470
AA Change: T275S

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027470
Gene: ENSMUSG00000026253
AA Change: T275S

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 241 7.9e-72 PFAM
Pfam:Neur_chan_memb 248 494 9.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050876
SMART Domains Protein: ENSMUSP00000053403
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 2.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076362
SMART Domains Protein: ENSMUSP00000075699
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113230
SMART Domains Protein: ENSMUSP00000108856
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 212 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113231
SMART Domains Protein: ENSMUSP00000108857
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 212 4.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113232
SMART Domains Protein: ENSMUSP00000108858
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113233
SMART Domains Protein: ENSMUSP00000108859
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 8.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113235
SMART Domains Protein: ENSMUSP00000108861
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 1.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123735
SMART Domains Protein: ENSMUSP00000137771
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 128 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185763
SMART Domains Protein: ENSMUSP00000139600
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 20 72 1.4e-6 PFAM
Pfam:Neur_chan_LBD 117 255 1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186038
SMART Domains Protein: ENSMUSP00000141001
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 220 1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188796
SMART Domains Protein: ENSMUSP00000140796
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 142 1.3e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian muscle-type acetylcholine receptor is a transmembrane pentameric glycoprotein with two alpha subunits, one beta, one delta, and one epsilon (in adult skeletal muscle) or gamma (in fetal and denervated muscle) subunit. This gene, which encodes the gamma subunit, is expressed prior to the thirty-third week of gestation in humans. The gamma subunit of the acetylcholine receptor plays a role in neuromuscular organogenesis and ligand binding and disruption of gamma subunit expression prevents the correct localization of the receptor in cell membranes. Mutations in this gene cause Escobar syndrome and a lethal form of multiple pterygium syndrome. Muscle-type acetylcholine receptor is the major antigen in the autoimmune disease myasthenia gravis.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display perinatal and postnatal lethality, paradoxical breathing, abnormal skeletal muscle morphology, abnormal neuromuscular junction morphology and physiology, and are unable to suckle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,832,809 (GRCm39) E122G probably benign Het
Adamts2 T C 11: 50,682,647 (GRCm39) Y880H probably damaging Het
Atp13a4 A G 16: 29,239,723 (GRCm39) S830P probably benign Het
Atp1a3 T A 7: 24,687,410 (GRCm39) Q696L probably benign Het
Brox G A 1: 183,073,523 (GRCm39) R85* probably null Het
C130073F10Rik T C 4: 101,747,439 (GRCm39) I197V probably benign Het
Cand2 G A 6: 115,768,153 (GRCm39) V433M probably damaging Het
Cep83 A G 10: 94,555,527 (GRCm39) K74E probably damaging Het
Clca3a2 T C 3: 144,789,869 (GRCm39) D489G probably damaging Het
Cmtr1 A G 17: 29,914,398 (GRCm39) probably null Het
Cnga1 T C 5: 72,775,592 (GRCm39) N43S probably benign Het
Cog8 A T 8: 107,782,984 (GRCm39) C102S probably damaging Het
Cpsf3 G A 12: 21,346,738 (GRCm39) probably null Het
Cyp26b1 G A 6: 84,554,132 (GRCm39) Q162* probably null Het
Elmod3 A G 6: 72,571,736 (GRCm39) F14S probably benign Het
Eps8 A G 6: 137,516,354 (GRCm39) S9P probably benign Het
Fam184b T C 5: 45,741,517 (GRCm39) Q238R probably damaging Het
Fbxw7 T C 3: 84,884,676 (GRCm39) L654S unknown Het
Foxp1 A T 6: 98,912,373 (GRCm39) L580Q unknown Het
Galr1 A G 18: 82,423,789 (GRCm39) S163P probably damaging Het
Ganc T C 2: 120,258,256 (GRCm39) F201L possibly damaging Het
Gin1 T C 1: 97,712,876 (GRCm39) F310L probably benign Het
Grik2 A T 10: 48,977,512 (GRCm39) probably null Het
Haus1 A T 18: 77,851,834 (GRCm39) F94I probably benign Het
Hcn4 A G 9: 58,760,682 (GRCm39) Y409C unknown Het
Hspa1l A G 17: 35,196,231 (GRCm39) K90R probably benign Het
Icam5 T C 9: 20,948,297 (GRCm39) S702P possibly damaging Het
Ifnar1 A G 16: 91,296,444 (GRCm39) H315R probably benign Het
Klra9 T C 6: 130,168,224 (GRCm39) H14R probably damaging Het
Krt78 A G 15: 101,855,829 (GRCm39) Y661H probably benign Het
Krtap11-1 T C 16: 89,367,813 (GRCm39) T69A possibly damaging Het
L3mbtl3 C A 10: 26,168,560 (GRCm39) S598I unknown Het
Lama1 A T 17: 68,059,441 (GRCm39) D608V Het
Lrrc55 G A 2: 85,026,784 (GRCm39) T80I probably damaging Het
Lyst A T 13: 13,818,094 (GRCm39) T1255S probably benign Het
Magi2 T C 5: 20,670,586 (GRCm39) V310A probably damaging Het
Med23 C A 10: 24,777,902 (GRCm39) A750D probably benign Het
Mmp2 G A 8: 93,558,414 (GRCm39) R161Q probably damaging Het
Myo15a A T 11: 60,387,321 (GRCm39) I733F probably benign Het
Ncan A T 8: 70,552,961 (GRCm39) F1090L possibly damaging Het
Or2ag2b T G 7: 106,418,202 (GRCm39) V304G probably damaging Het
Otulinl G A 15: 27,658,273 (GRCm39) T199M probably benign Het
Pafah1b1 A G 11: 74,573,104 (GRCm39) I320T probably damaging Het
Pcdhb1 T A 18: 37,399,740 (GRCm39) Y564N probably damaging Het
Pear1 A G 3: 87,657,596 (GRCm39) S988P probably benign Het
Pgam2 A C 11: 5,753,013 (GRCm39) V194G probably damaging Het
Plvap A T 8: 71,964,221 (GRCm39) I47N probably damaging Het
Prdx6 A T 1: 161,074,867 (GRCm39) L71H probably damaging Het
Psmb11 G A 14: 54,863,408 (GRCm39) V209M probably damaging Het
Ptprn2 G A 12: 117,190,845 (GRCm39) probably null Het
Rcn2 T A 9: 55,964,763 (GRCm39) N240K probably benign Het
Rsad2 A T 12: 26,504,122 (GRCm39) Y136N probably damaging Het
Slc12a4 T G 8: 106,673,369 (GRCm39) Q734P probably benign Het
Smarcc2 T A 10: 128,323,917 (GRCm39) M1085K unknown Het
Smg1 A T 7: 117,776,178 (GRCm39) C1371S probably benign Het
Spg11 A T 2: 121,938,585 (GRCm39) F456L probably damaging Het
Srsf10 C T 4: 135,583,528 (GRCm39) probably benign Het
Stxbp5 T C 10: 9,673,931 (GRCm39) Y4C probably damaging Het
Tdrd12 T A 7: 35,179,705 (GRCm39) D881V unknown Het
Tmem171 T C 13: 98,829,133 (GRCm39) T6A probably benign Het
Tmem220 T C 11: 66,916,989 (GRCm39) L55P unknown Het
Ttn G T 2: 76,677,125 (GRCm39) P11037Q unknown Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Usp47 T C 7: 111,692,084 (GRCm39) S849P probably benign Het
Vcan G A 13: 89,853,389 (GRCm39) P524S possibly damaging Het
Vmn1r18 A G 6: 57,367,083 (GRCm39) M157T probably benign Het
Vmn2r109 A T 17: 20,761,225 (GRCm39) C711S possibly damaging Het
Wasf3 C T 5: 146,392,463 (GRCm39) R178C probably damaging Het
Wdr76 G A 2: 121,359,401 (GRCm39) V231I probably damaging Het
Xirp2 A T 2: 67,355,895 (GRCm39) N3552I probably damaging Het
Zfp804a A G 2: 82,088,969 (GRCm39) T933A probably benign Het
Zmynd8 A G 2: 165,699,973 (GRCm39) probably null Het
Zranb3 A T 1: 127,968,630 (GRCm39) I95K probably benign Het
Other mutations in Chrng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Chrng APN 1 87,134,469 (GRCm39) missense probably damaging 0.99
IGL02947:Chrng APN 1 87,137,606 (GRCm39) splice site probably null
IGL03014:Chrng UTSW 1 87,138,759 (GRCm39) critical splice donor site probably null
R1051:Chrng UTSW 1 87,136,785 (GRCm39) missense possibly damaging 0.70
R1346:Chrng UTSW 1 87,135,985 (GRCm39) missense probably benign 0.09
R1368:Chrng UTSW 1 87,133,575 (GRCm39) missense probably damaging 1.00
R1588:Chrng UTSW 1 87,135,229 (GRCm39) missense probably damaging 1.00
R1703:Chrng UTSW 1 87,138,628 (GRCm39) missense possibly damaging 0.63
R2852:Chrng UTSW 1 87,134,428 (GRCm39) missense probably benign 0.01
R3707:Chrng UTSW 1 87,138,333 (GRCm39) nonsense probably null
R4780:Chrng UTSW 1 87,135,246 (GRCm39) missense probably damaging 1.00
R5818:Chrng UTSW 1 87,137,523 (GRCm39) missense probably benign 0.45
R5871:Chrng UTSW 1 87,134,451 (GRCm39) missense possibly damaging 0.95
R6058:Chrng UTSW 1 87,139,074 (GRCm39) missense probably damaging 1.00
R6136:Chrng UTSW 1 87,137,523 (GRCm39) missense probably benign 0.45
R7086:Chrng UTSW 1 87,138,735 (GRCm39) missense probably benign 0.06
R7261:Chrng UTSW 1 87,134,962 (GRCm39) splice site probably null
R7572:Chrng UTSW 1 87,136,836 (GRCm39) missense probably damaging 1.00
R7666:Chrng UTSW 1 87,137,175 (GRCm39) missense probably benign 0.05
R8132:Chrng UTSW 1 87,133,718 (GRCm39) missense unknown
R8865:Chrng UTSW 1 87,135,219 (GRCm39) missense probably damaging 1.00
R8902:Chrng UTSW 1 87,138,397 (GRCm39) missense possibly damaging 0.84
R9535:Chrng UTSW 1 87,139,202 (GRCm39) missense probably benign 0.00
T0975:Chrng UTSW 1 87,138,348 (GRCm39) missense probably benign 0.00
X0063:Chrng UTSW 1 87,134,428 (GRCm39) missense probably benign 0.01
Z1177:Chrng UTSW 1 87,134,020 (GRCm39) missense probably benign 0.10
Z1177:Chrng UTSW 1 87,133,717 (GRCm39) missense unknown
Z1177:Chrng UTSW 1 87,136,025 (GRCm39) missense probably damaging 0.99
Z1177:Chrng UTSW 1 87,135,985 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCTTATGACACAGGGCAC -3'
(R):5'- TGGAAGGAAGGCCATTGTC -3'

Sequencing Primer
(F):5'- CCACAATCCTAGGACAAGGGTAGTG -3'
(R):5'- GGAAGGCCATTGTCAAAAGCCTC -3'
Posted On 2019-06-26