Mutagenetix > Incidental Mutations

Incidental Mutation 'R7229:Ganc'

562331

Institutional Source

Beutler Lab

Gene Symbol

Ganc

Ensembl Gene

ENSMUSG00000062646

Gene Name

glucosidase, alpha; neutral C

Synonyms

5830445O15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.825) question?

Stock #

R7229 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120403896-120461700 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120427775 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 201 (F201L)

Ref Sequence

ENSEMBL: ENSMUSP00000116898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000135074]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135074
AA Change: F201L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: F201L

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	221	292	2.3e-21	PFAM
Pfam:Glyco_hydro_31	333	778	2.5e-137	PFAM

Meta Mutation Damage Score

0.1488

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	T	C	14: 54,595,352	E122G	probably benign	Het
Adamts2	T	C	11: 50,791,820	Y880H	probably damaging	Het
Atp13a4	A	G	16: 29,420,905	S830P	probably benign	Het
Atp1a3	T	A	7: 24,987,985	Q696L	probably benign	Het
Brox	G	A	1: 183,291,959	R85*	probably null	Het
C130073F10Rik	T	C	4: 101,890,242	I197V	probably benign	Het
Cand2	G	A	6: 115,791,192	V433M	probably damaging	Het
Cep83	A	G	10: 94,719,665	K74E	probably damaging	Het
Chrng	A	T	1: 87,209,444	T275S	probably benign	Het
Clca2	T	C	3: 145,084,108	D489G	probably damaging	Het
Cmtr1	A	G	17: 29,695,424		probably null	Het
Cnga1	T	C	5: 72,618,249	N43S	probably benign	Het
Cog8	A	T	8: 107,056,352	C102S	probably damaging	Het
Cpsf3	G	A	12: 21,296,737		probably null	Het
Cyp26b1	G	A	6: 84,577,150	Q162*	probably null	Het
Elmod3	A	G	6: 72,594,753	F14S	probably benign	Het
Eps8	A	G	6: 137,539,356	S9P	probably benign	Het
Fam105a	G	A	15: 27,658,187	T199M	probably benign	Het
Fam184b	T	C	5: 45,584,175	Q238R	probably damaging	Het
Fbxw7	T	C	3: 84,977,369	L654S	unknown	Het
Foxp1	A	T	6: 98,935,412	L580Q	unknown	Het
Galr1	A	G	18: 82,405,664	S163P	probably damaging	Het
Gin1	T	C	1: 97,785,151	F310L	probably benign	Het
Grik2	A	T	10: 49,101,416		probably null	Het
Haus1	A	T	18: 77,764,134	F94I	probably benign	Het
Hcn4	A	G	9: 58,853,399	Y409C	unknown	Het
Hspa1l	A	G	17: 34,977,255	K90R	probably benign	Het
Icam5	T	C	9: 21,037,001	S702P	possibly damaging	Het
Ifnar1	A	G	16: 91,499,556	H315R	probably benign	Het
Klra9	T	C	6: 130,191,261	H14R	probably damaging	Het
Krt78	A	G	15: 101,947,394	Y661H	probably benign	Het
Krtap11-1	T	C	16: 89,570,925	T69A	possibly damaging	Het
L3mbtl3	C	A	10: 26,292,662	S598I	unknown	Het
Lama1	A	T	17: 67,752,446	D608V		Het
Lrrc55	G	A	2: 85,196,440	T80I	probably damaging	Het
Lyst	A	T	13: 13,643,509	T1255S	probably benign	Het
Magi2	T	C	5: 20,465,588	V310A	probably damaging	Het
Med23	C	A	10: 24,902,004	A750D	probably benign	Het
Mmp2	G	A	8: 92,831,786	R161Q	probably damaging	Het
Myo15	A	T	11: 60,496,495	I733F	probably benign	Het
Ncan	A	T	8: 70,100,311	F1090L	possibly damaging	Het
Olfr701	T	G	7: 106,818,995	V304G	probably damaging	Het
Pafah1b1	A	G	11: 74,682,278	I320T	probably damaging	Het
Pcdhb1	T	A	18: 37,266,687	Y564N	probably damaging	Het
Pear1	A	G	3: 87,750,289	S988P	probably benign	Het
Pgam2	A	C	11: 5,803,013	V194G	probably damaging	Het
Plvap	A	T	8: 71,511,577	I47N	probably damaging	Het
Prdx6	A	T	1: 161,247,297	L71H	probably damaging	Het
Psmb11	G	A	14: 54,625,951	V209M	probably damaging	Het
Ptprn2	G	A	12: 117,227,225		probably null	Het
Rcn2	T	A	9: 56,057,479	N240K	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Slc12a4	T	G	8: 105,946,737	Q734P	probably benign	Het
Smarcc2	T	A	10: 128,488,048	M1085K	unknown	Het
Smg1	A	T	7: 118,176,955	C1371S	probably benign	Het
Spg11	A	T	2: 122,108,104	F456L	probably damaging	Het
Srsf10	C	T	4: 135,856,217		probably benign	Het
Stxbp5	T	C	10: 9,798,187	Y4C	probably damaging	Het
Tdrd12	T	A	7: 35,480,280	D881V	unknown	Het
Tmem171	T	C	13: 98,692,625	T6A	probably benign	Het
Tmem220	T	C	11: 67,026,163	L55P	unknown	Het
Ttn	G	T	2: 76,846,781	P11037Q	unknown	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Usp47	T	C	7: 112,092,877	S849P	probably benign	Het
Vcan	G	A	13: 89,705,270	P524S	possibly damaging	Het
Vmn1r18	A	G	6: 57,390,098	M157T	probably benign	Het
Vmn2r109	A	T	17: 20,540,963	C711S	possibly damaging	Het
Wasf3	C	T	5: 146,455,653	R178C	probably damaging	Het
Wdr76	G	A	2: 121,528,920	V231I	probably damaging	Het
Xirp2	A	T	2: 67,525,551	N3552I	probably damaging	Het
Zfp804a	A	G	2: 82,258,625	T933A	probably benign	Het
Zmynd8	A	G	2: 165,858,053		probably null	Het
Zranb3	A	T	1: 128,040,893	I95K	probably benign	Het

Other mutations in Ganc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Ganc	APN	2	120441598	missense	probably damaging	1.00
IGL00913:Ganc	APN	2	120439452	splice site	probably benign
IGL01077:Ganc	APN	2	120446515	missense	possibly damaging	0.50
IGL01773:Ganc	APN	2	120459884	missense	possibly damaging	0.87
IGL01812:Ganc	APN	2	120411526	missense	probably benign	0.00
IGL02029:Ganc	APN	2	120459857	missense	probably benign	0.00
IGL02067:Ganc	APN	2	120406304	missense	probably benign	0.16
IGL02290:Ganc	APN	2	120448423	missense	possibly damaging	0.90
IGL02355:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02362:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02553:Ganc	APN	2	120458134	missense	probably benign
IGL02808:Ganc	APN	2	120411511	missense	probably benign	0.00
IGL02966:Ganc	APN	2	120433648	missense	probably damaging	1.00
IGL03356:Ganc	APN	2	120435288	missense	probably benign	0.22
IGL03405:Ganc	APN	2	120433766	missense	probably damaging	1.00
ingenuous	UTSW	2	120444149	missense	probably damaging	1.00
R0464:Ganc	UTSW	2	120436694	missense	probably benign	0.07
R0511:Ganc	UTSW	2	120448401	nonsense	probably null
R0932:Ganc	UTSW	2	120458129	missense	probably damaging	0.99
R1467:Ganc	UTSW	2	120430928	splice site	probably benign
R1902:Ganc	UTSW	2	120446482	missense	probably damaging	1.00
R2087:Ganc	UTSW	2	120457257	missense	probably damaging	1.00
R4668:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4669:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4725:Ganc	UTSW	2	120435273	missense	probably damaging	0.99
R4735:Ganc	UTSW	2	120436623	splice site	silent
R4738:Ganc	UTSW	2	120452594	missense	probably damaging	0.97
R4839:Ganc	UTSW	2	120459823	missense	probably benign
R4951:Ganc	UTSW	2	120456047	missense	probably benign	0.00
R5841:Ganc	UTSW	2	120411539	missense	possibly damaging	0.65
R5997:Ganc	UTSW	2	120430605	missense	possibly damaging	0.55
R6142:Ganc	UTSW	2	120430737	critical splice donor site	probably null
R6378:Ganc	UTSW	2	120433826	missense	probably damaging	1.00
R6711:Ganc	UTSW	2	120450839	missense	possibly damaging	0.74
R6777:Ganc	UTSW	2	120444149	missense	probably damaging	1.00
R7235:Ganc	UTSW	2	120433717	missense	probably damaging	1.00
R7241:Ganc	UTSW	2	120441529	missense	probably damaging	1.00
R7326:Ganc	UTSW	2	120430599	missense	probably damaging	1.00
R7567:Ganc	UTSW	2	120456101	missense	probably benign	0.01
R7685:Ganc	UTSW	2	120433792	missense	probably damaging	1.00
R7736:Ganc	UTSW	2	120433814	missense	possibly damaging	0.83
R7784:Ganc	UTSW	2	120436668	nonsense	probably null
R7955:Ganc	UTSW	2	120430700	missense	probably damaging	1.00
R8222:Ganc	UTSW	2	120446452	missense	probably damaging	1.00
R8247:Ganc	UTSW	2	120436700	missense	probably null	0.52
R8306:Ganc	UTSW	2	120422079	missense	probably benign	0.02
R9282:Ganc	UTSW	2	120459900	missense	probably benign
X0027:Ganc	UTSW	2	120448450	missense	probably damaging	1.00
Z1177:Ganc	UTSW	2	120433794	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAATGTGGACTCATATTCTGTCTTT -3'
(R):5'- TTAGGTGCCAAAGCTCAAGG -3'

Sequencing Primer
(F):5'- CGGGGATTAAACCTGAGTTGTCAATC -3'
(R):5'- CTATCTATGCTACTGGGGATTGAAC -3'

Posted On

2019-06-26