Mutagenetix > Incidental Mutations

Incidental Mutation 'R7229:Clca2'

562337

Institutional Source

Beutler Lab

Gene Symbol

Clca2

Ensembl Gene

ENSMUSG00000036960

Gene Name

chloride channel accessory 2

Synonyms

Clca5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7229 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145070263-145099443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 145084108 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 489 (D489G)

Ref Sequence

ENSEMBL: ENSMUSP00000036029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040465
AA Change: D489G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: D489G

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
VWA	309	485	3.55e-5	SMART
low complexity region	739	754	N/A	INTRINSIC
Blast:FN3	765	875	5e-21	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000198993
AA Change: D489G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960
AA Change: D489G

Domain	Start	End	E-Value	Type
Pfam:CLCA_N	7	265	1.7e-121	PFAM
VWA	309	485	2.2e-7	SMART
Pfam:DUF1973	494	674	7.8e-75	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: This gene encodes a member of the calcium-activated chloride channel regulator (CLCR) family of proteins. Members of this family regulate the transport of chloride across the plasma membrane. Expression of this gene is upregulated by the tumor suppressor protein p53 in response to DNA damage. Mice lacking a functional copy of this gene exhibit increased liver weight and hepatocyte hypertrophy. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit increases in liver weight to body weight ratio and hepatocyte hypertrophy; one incidence of multifocal hepatic necrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	T	C	14: 54,595,352	E122G	probably benign	Het
Adamts2	T	C	11: 50,791,820	Y880H	probably damaging	Het
Atp13a4	A	G	16: 29,420,905	S830P	probably benign	Het
Atp1a3	T	A	7: 24,987,985	Q696L	probably benign	Het
Brox	G	A	1: 183,291,959	R85*	probably null	Het
C130073F10Rik	T	C	4: 101,890,242	I197V	probably benign	Het
Cand2	G	A	6: 115,791,192	V433M	probably damaging	Het
Cep83	A	G	10: 94,719,665	K74E	probably damaging	Het
Chrng	A	T	1: 87,209,444	T275S	probably benign	Het
Cmtr1	A	G	17: 29,695,424		probably null	Het
Cnga1	T	C	5: 72,618,249	N43S	probably benign	Het
Cog8	A	T	8: 107,056,352	C102S	probably damaging	Het
Cpsf3	G	A	12: 21,296,737		probably null	Het
Cyp26b1	G	A	6: 84,577,150	Q162*	probably null	Het
Elmod3	A	G	6: 72,594,753	F14S	probably benign	Het
Eps8	A	G	6: 137,539,356	S9P	probably benign	Het
Fam105a	G	A	15: 27,658,187	T199M	probably benign	Het
Fam184b	T	C	5: 45,584,175	Q238R	probably damaging	Het
Fbxw7	T	C	3: 84,977,369	L654S	unknown	Het
Foxp1	A	T	6: 98,935,412	L580Q	unknown	Het
Galr1	A	G	18: 82,405,664	S163P	probably damaging	Het
Ganc	T	C	2: 120,427,775	F201L	possibly damaging	Het
Gin1	T	C	1: 97,785,151	F310L	probably benign	Het
Grik2	A	T	10: 49,101,416		probably null	Het
Haus1	A	T	18: 77,764,134	F94I	probably benign	Het
Hcn4	A	G	9: 58,853,399	Y409C	unknown	Het
Hspa1l	A	G	17: 34,977,255	K90R	probably benign	Het
Icam5	T	C	9: 21,037,001	S702P	possibly damaging	Het
Ifnar1	A	G	16: 91,499,556	H315R	probably benign	Het
Klra9	T	C	6: 130,191,261	H14R	probably damaging	Het
Krt78	A	G	15: 101,947,394	Y661H	probably benign	Het
Krtap11-1	T	C	16: 89,570,925	T69A	possibly damaging	Het
L3mbtl3	C	A	10: 26,292,662	S598I	unknown	Het
Lama1	A	T	17: 67,752,446	D608V		Het
Lrrc55	G	A	2: 85,196,440	T80I	probably damaging	Het
Lyst	A	T	13: 13,643,509	T1255S	probably benign	Het
Magi2	T	C	5: 20,465,588	V310A	probably damaging	Het
Med23	C	A	10: 24,902,004	A750D	probably benign	Het
Mmp2	G	A	8: 92,831,786	R161Q	probably damaging	Het
Myo15	A	T	11: 60,496,495	I733F	probably benign	Het
Ncan	A	T	8: 70,100,311	F1090L	possibly damaging	Het
Olfr701	T	G	7: 106,818,995	V304G	probably damaging	Het
Pafah1b1	A	G	11: 74,682,278	I320T	probably damaging	Het
Pcdhb1	T	A	18: 37,266,687	Y564N	probably damaging	Het
Pear1	A	G	3: 87,750,289	S988P	probably benign	Het
Pgam2	A	C	11: 5,803,013	V194G	probably damaging	Het
Plvap	A	T	8: 71,511,577	I47N	probably damaging	Het
Prdx6	A	T	1: 161,247,297	L71H	probably damaging	Het
Psmb11	G	A	14: 54,625,951	V209M	probably damaging	Het
Ptprn2	G	A	12: 117,227,225		probably null	Het
Rcn2	T	A	9: 56,057,479	N240K	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Slc12a4	T	G	8: 105,946,737	Q734P	probably benign	Het
Smarcc2	T	A	10: 128,488,048	M1085K	unknown	Het
Smg1	A	T	7: 118,176,955	C1371S	probably benign	Het
Spg11	A	T	2: 122,108,104	F456L	probably damaging	Het
Srsf10	C	T	4: 135,856,217		probably benign	Het
Stxbp5	T	C	10: 9,798,187	Y4C	probably damaging	Het
Tdrd12	T	A	7: 35,480,280	D881V	unknown	Het
Tmem171	T	C	13: 98,692,625	T6A	probably benign	Het
Tmem220	T	C	11: 67,026,163	L55P	unknown	Het
Ttn	G	T	2: 76,846,781	P11037Q	unknown	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Usp47	T	C	7: 112,092,877	S849P	probably benign	Het
Vcan	G	A	13: 89,705,270	P524S	possibly damaging	Het
Vmn1r18	A	G	6: 57,390,098	M157T	probably benign	Het
Vmn2r109	A	T	17: 20,540,963	C711S	possibly damaging	Het
Wasf3	C	T	5: 146,455,653	R178C	probably damaging	Het
Wdr76	G	A	2: 121,528,920	V231I	probably damaging	Het
Xirp2	A	T	2: 67,525,551	N3552I	probably damaging	Het
Zfp804a	A	G	2: 82,258,625	T933A	probably benign	Het
Zmynd8	A	G	2: 165,858,053		probably null	Het
Zranb3	A	T	1: 128,040,893	I95K	probably benign	Het

Other mutations in Clca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Clca2	APN	3	145098813	missense	probably damaging	1.00
IGL01337:Clca2	APN	3	145095178	missense	probably damaging	1.00
IGL01389:Clca2	APN	3	145077868	critical splice donor site	probably null
IGL01595:Clca2	APN	3	145088007	missense	probably damaging	1.00
IGL01704:Clca2	APN	3	145095218	missense	probably benign	0.04
IGL02416:Clca2	APN	3	145085016	missense	probably benign	0.02
IGL02455:Clca2	APN	3	145081411	missense	probably benign	0.00
IGL02481:Clca2	APN	3	145084940	missense	possibly damaging	0.92
IGL02526:Clca2	APN	3	145088018	missense	probably benign	0.02
IGL02797:Clca2	APN	3	145081263	missense	probably benign	0.02
IGL03253:Clca2	APN	3	145071563	missense	probably benign	0.41
IGL03256:Clca2	APN	3	145086392	missense	possibly damaging	0.75
IGL03294:Clca2	APN	3	145097769	missense	probably damaging	1.00
3370:Clca2	UTSW	3	145077977	missense	probably damaging	1.00
R0479:Clca2	UTSW	3	145090849	missense	probably damaging	1.00
R0542:Clca2	UTSW	3	145075810	splice site	probably benign
R0629:Clca2	UTSW	3	145072239	missense	probably benign
R1488:Clca2	UTSW	3	145084164	missense	possibly damaging	0.49
R1523:Clca2	UTSW	3	145071644	nonsense	probably null
R1568:Clca2	UTSW	3	145075649	nonsense	probably null
R1650:Clca2	UTSW	3	145092212	missense	probably damaging	1.00
R1771:Clca2	UTSW	3	145081410	missense	probably benign	0.12
R2101:Clca2	UTSW	3	145077938	missense	probably damaging	0.99
R2242:Clca2	UTSW	3	145090790	missense	probably damaging	0.98
R3751:Clca2	UTSW	3	145071455	missense	probably benign	0.04
R4496:Clca2	UTSW	3	145092165	missense	possibly damaging	0.94
R4962:Clca2	UTSW	3	145077879	missense	probably damaging	1.00
R5344:Clca2	UTSW	3	145087942	missense	probably damaging	1.00
R5424:Clca2	UTSW	3	145084181	missense	probably damaging	0.99
R5931:Clca2	UTSW	3	145092125	missense	possibly damaging	0.88
R6181:Clca2	UTSW	3	145090708	nonsense	probably null
R6598:Clca2	UTSW	3	145086485	nonsense	probably null
R7167:Clca2	UTSW	3	145097784	missense	probably benign	0.40
R7256:Clca2	UTSW	3	145090847	missense	probably damaging	0.99
R7365:Clca2	UTSW	3	145098784	missense	probably damaging	1.00
X0025:Clca2	UTSW	3	145086504	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- ACAACTCCTGGAACTGAGCC -3'
(R):5'- AGTGAGCAAAGCACATCTCC -3'

Sequencing Primer
(F):5'- CTGGAACTGAGCCGTACAGAC -3'
(R):5'- CCAGCACTTTCTTGTAGACACAG -3'

Posted On

2019-06-26