Incidental Mutation 'R7229:Clca2'
ID562337
Institutional Source Beutler Lab
Gene Symbol Clca2
Ensembl Gene ENSMUSG00000036960
Gene Namechloride channel accessory 2
SynonymsClca5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location145070263-145099443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145084108 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 489 (D489G)
Ref Sequence ENSEMBL: ENSMUSP00000036029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]
Predicted Effect probably damaging
Transcript: ENSMUST00000040465
AA Change: D489G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: D489G

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
VWA 309 485 3.55e-5 SMART
low complexity region 739 754 N/A INTRINSIC
Blast:FN3 765 875 5e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000198993
AA Change: D489G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960
AA Change: D489G

DomainStartEndE-ValueType
Pfam:CLCA_N 7 265 1.7e-121 PFAM
VWA 309 485 2.2e-7 SMART
Pfam:DUF1973 494 674 7.8e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes a member of the calcium-activated chloride channel regulator (CLCR) family of proteins. Members of this family regulate the transport of chloride across the plasma membrane. Expression of this gene is upregulated by the tumor suppressor protein p53 in response to DNA damage. Mice lacking a functional copy of this gene exhibit increased liver weight and hepatocyte hypertrophy. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit increases in liver weight to body weight ratio and hepatocyte hypertrophy; one incidence of multifocal hepatic necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Clca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca2 APN 3 145098813 missense probably damaging 1.00
IGL01337:Clca2 APN 3 145095178 missense probably damaging 1.00
IGL01389:Clca2 APN 3 145077868 critical splice donor site probably null
IGL01595:Clca2 APN 3 145088007 missense probably damaging 1.00
IGL01704:Clca2 APN 3 145095218 missense probably benign 0.04
IGL02416:Clca2 APN 3 145085016 missense probably benign 0.02
IGL02455:Clca2 APN 3 145081411 missense probably benign 0.00
IGL02481:Clca2 APN 3 145084940 missense possibly damaging 0.92
IGL02526:Clca2 APN 3 145088018 missense probably benign 0.02
IGL02797:Clca2 APN 3 145081263 missense probably benign 0.02
IGL03253:Clca2 APN 3 145071563 missense probably benign 0.41
IGL03256:Clca2 APN 3 145086392 missense possibly damaging 0.75
IGL03294:Clca2 APN 3 145097769 missense probably damaging 1.00
3370:Clca2 UTSW 3 145077977 missense probably damaging 1.00
R0479:Clca2 UTSW 3 145090849 missense probably damaging 1.00
R0542:Clca2 UTSW 3 145075810 splice site probably benign
R0629:Clca2 UTSW 3 145072239 missense probably benign
R1488:Clca2 UTSW 3 145084164 missense possibly damaging 0.49
R1523:Clca2 UTSW 3 145071644 nonsense probably null
R1568:Clca2 UTSW 3 145075649 nonsense probably null
R1650:Clca2 UTSW 3 145092212 missense probably damaging 1.00
R1771:Clca2 UTSW 3 145081410 missense probably benign 0.12
R2101:Clca2 UTSW 3 145077938 missense probably damaging 0.99
R2242:Clca2 UTSW 3 145090790 missense probably damaging 0.98
R3751:Clca2 UTSW 3 145071455 missense probably benign 0.04
R4496:Clca2 UTSW 3 145092165 missense possibly damaging 0.94
R4962:Clca2 UTSW 3 145077879 missense probably damaging 1.00
R5344:Clca2 UTSW 3 145087942 missense probably damaging 1.00
R5424:Clca2 UTSW 3 145084181 missense probably damaging 0.99
R5931:Clca2 UTSW 3 145092125 missense possibly damaging 0.88
R6181:Clca2 UTSW 3 145090708 nonsense probably null
R6598:Clca2 UTSW 3 145086485 nonsense probably null
R7167:Clca2 UTSW 3 145097784 missense probably benign 0.40
R7256:Clca2 UTSW 3 145090847 missense probably damaging 0.99
R7365:Clca2 UTSW 3 145098784 missense probably damaging 1.00
X0025:Clca2 UTSW 3 145086504 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACAACTCCTGGAACTGAGCC -3'
(R):5'- AGTGAGCAAAGCACATCTCC -3'

Sequencing Primer
(F):5'- CTGGAACTGAGCCGTACAGAC -3'
(R):5'- CCAGCACTTTCTTGTAGACACAG -3'
Posted On2019-06-26