Incidental Mutation 'R0576:Fa2h'
ID56234
Institutional Source Beutler Lab
Gene Symbol Fa2h
Ensembl Gene ENSMUSG00000033579
Gene Namefatty acid 2-hydroxylase
SynonymsFaxdc1, G630055L08Rik
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R0576 (G1)
Quality Score96
Status Validated
Chromosome8
Chromosomal Location111345135-111393824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111356147 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 146 (H146R)
Ref Sequence ENSEMBL: ENSMUSP00000043597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038475]
Predicted Effect probably damaging
Transcript: ENSMUST00000038475
AA Change: H146R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043597
Gene: ENSMUSG00000033579
AA Change: H146R

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Cyt-b5 11 86 2.85e-15 SMART
low complexity region 115 126 N/A INTRINSIC
transmembrane domain 169 191 N/A INTRINSIC
Pfam:FA_hydroxylase 219 361 4.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162463
Meta Mutation Damage Score 0.6510 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele show demyelination, axonal loss, and cerebellar dysfunction. Homozygotes for a different null allele show late onset axon and myelin sheath degeneration, delayed fur emergence, altered sebum composition, sebocyte hyperproliferation, and cyclic alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Fa2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Fa2h APN 8 111349304 missense possibly damaging 0.55
IGL02983:Fa2h APN 8 111346522 critical splice acceptor site probably null
IGL03350:Fa2h APN 8 111349296 missense probably benign 0.05
sparse UTSW 8 111355398 critical splice donor site probably null
R0016:Fa2h UTSW 8 111393514 missense probably damaging 1.00
R0363:Fa2h UTSW 8 111349289 missense probably damaging 1.00
R2914:Fa2h UTSW 8 111393649 missense probably damaging 1.00
R3803:Fa2h UTSW 8 111355398 critical splice donor site probably null
R3924:Fa2h UTSW 8 111393515 missense probably damaging 1.00
R5203:Fa2h UTSW 8 111349364 missense probably benign 0.00
R5253:Fa2h UTSW 8 111349237 missense probably benign 0.00
R6547:Fa2h UTSW 8 111348020 missense probably damaging 1.00
R7595:Fa2h UTSW 8 111355490 missense probably benign 0.01
R8050:Fa2h UTSW 8 111348185 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCACAGGGAAGGATGTTACCCAG -3'
(R):5'- CACACAAGCTGAGATGGTGCTAAGG -3'

Sequencing Primer
(F):5'- GGATCTAGCCTGTCACACC -3'
(R):5'- CTGAGATGGTGCTAAGGAACAG -3'
Posted On2013-07-11