Incidental Mutation 'R0576:Qars'
ID56235
Institutional Source Beutler Lab
Gene Symbol Qars
Ensembl Gene ENSMUSG00000032604
Gene Nameglutaminyl-tRNA synthetase
Synonyms1110018N24Rik, 1200016L19Rik
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0576 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108507706-108515941 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 108514962 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006838] [ENSMUST00000006851] [ENSMUST00000112155] [ENSMUST00000134939] [ENSMUST00000194045] [ENSMUST00000207790] [ENSMUST00000192819] [ENSMUST00000192932] [ENSMUST00000193258] [ENSMUST00000195563] [ENSMUST00000195513] [ENSMUST00000194385] [ENSMUST00000193348] [ENSMUST00000208214] [ENSMUST00000208177] [ENSMUST00000207862] [ENSMUST00000208581] [ENSMUST00000207947] [ENSMUST00000208162] [ENSMUST00000207810]
Predicted Effect probably benign
Transcript: ENSMUST00000006838
SMART Domains Protein: ENSMUSP00000006838
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 4 162 1.2e-54 PFAM
Pfam:tRNA_synt_1c_R2 165 256 6.5e-31 PFAM
Pfam:tRNA-synt_1c 263 563 4.5e-119 PFAM
Pfam:tRNA-synt_1c_C 565 752 6.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006851
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112155
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131005
Predicted Effect probably benign
Transcript: ENSMUST00000134939
SMART Domains Protein: ENSMUSP00000122918
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 1 163 1.1e-55 PFAM
Pfam:tRNA_synt_1c_R2 164 256 6.9e-31 PFAM
Pfam:tRNA-synt_1c 263 563 2.5e-115 PFAM
Pfam:tRNA-synt_1c_C 565 720 5.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141780
Predicted Effect probably benign
Transcript: ENSMUST00000141903
SMART Domains Protein: ENSMUSP00000121146
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 2 148 2.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194045
Predicted Effect probably benign
Transcript: ENSMUST00000207180
Predicted Effect probably benign
Transcript: ENSMUST00000207790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192331
Predicted Effect probably benign
Transcript: ENSMUST00000207713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192065
Predicted Effect probably benign
Transcript: ENSMUST00000207734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144253
Predicted Effect probably benign
Transcript: ENSMUST00000192819
SMART Domains Protein: ENSMUSP00000142027
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 1e-3 SMART
low complexity region 85 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192932
SMART Domains Protein: ENSMUSP00000141215
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193258
SMART Domains Protein: ENSMUSP00000141267
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195563
SMART Domains Protein: ENSMUSP00000141716
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195513
SMART Domains Protein: ENSMUSP00000142025
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194385
SMART Domains Protein: ENSMUSP00000142211
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1cy5a_ 9 45 8e-3 SMART
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193348
SMART Domains Protein: ENSMUSP00000141691
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 1e-3 SMART
low complexity region 80 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208214
Predicted Effect probably benign
Transcript: ENSMUST00000208177
Predicted Effect probably benign
Transcript: ENSMUST00000208506
Predicted Effect probably benign
Transcript: ENSMUST00000207862
Predicted Effect probably benign
Transcript: ENSMUST00000208581
Predicted Effect probably benign
Transcript: ENSMUST00000207947
Predicted Effect probably benign
Transcript: ENSMUST00000208162
Predicted Effect probably benign
Transcript: ENSMUST00000208962
Predicted Effect probably benign
Transcript: ENSMUST00000207810
Predicted Effect probably benign
Transcript: ENSMUST00000208074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208069
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Qars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Qars APN 9 108511539 missense probably damaging 1.00
IGL02336:Qars APN 9 108514986 nonsense probably null
IGL02393:Qars APN 9 108514329 missense probably benign 0.00
IGL03102:Qars APN 9 108508919 missense probably benign 0.35
R1777:Qars UTSW 9 108508201 critical splice donor site probably null
R1824:Qars UTSW 9 108514610 missense probably damaging 1.00
R1871:Qars UTSW 9 108514116 unclassified probably null
R1897:Qars UTSW 9 108514083 nonsense probably null
R1952:Qars UTSW 9 108513181 missense probably benign 0.35
R1981:Qars UTSW 9 108515028 missense probably damaging 1.00
R2172:Qars UTSW 9 108509200 missense probably damaging 1.00
R2698:Qars UTSW 9 108508443 missense possibly damaging 0.65
R4381:Qars UTSW 9 108510183 unclassified probably benign
R4608:Qars UTSW 9 108509426 splice site probably null
R4677:Qars UTSW 9 108509690 unclassified probably benign
R4974:Qars UTSW 9 108508931 missense probably damaging 1.00
R5234:Qars UTSW 9 108514165 missense probably damaging 1.00
R5548:Qars UTSW 9 108512918 missense possibly damaging 0.72
R5817:Qars UTSW 9 108510242 unclassified probably benign
R6029:Qars UTSW 9 108513690 missense probably damaging 1.00
R6110:Qars UTSW 9 108508098 missense probably benign 0.02
R6889:Qars UTSW 9 108513183 missense probably damaging 0.98
R7034:Qars UTSW 9 108514777 missense probably damaging 1.00
R7036:Qars UTSW 9 108514777 missense probably damaging 1.00
R7136:Qars UTSW 9 108512772 missense probably damaging 1.00
R7178:Qars UTSW 9 108515123 missense possibly damaging 0.50
R7192:Qars UTSW 9 108511561 missense probably damaging 1.00
R7235:Qars UTSW 9 108510132 missense probably damaging 1.00
R7813:Qars UTSW 9 108509471 missense probably damaging 1.00
R8248:Qars UTSW 9 108509452 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGCTTGGAGGTGACCTGTAGAC -3'
(R):5'- CGCTCAAACTGGAACTTGTCAAAGG -3'

Sequencing Primer
(F):5'- ACCTGTAGACGAGCTGATGC -3'
(R):5'- AACTTGTCAAAGGGCTTTGC -3'
Posted On2013-07-11