Incidental Mutation 'R7229:Eps8'
ID562350
Institutional Source Beutler Lab
Gene Symbol Eps8
Ensembl Gene ENSMUSG00000015766
Gene Nameepidermal growth factor receptor pathway substrate 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7229 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location137477245-137654876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137539356 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 9 (S9P)
Ref Sequence ENSEMBL: ENSMUSP00000052776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058210] [ENSMUST00000100841] [ENSMUST00000111878] [ENSMUST00000132920] [ENSMUST00000134630] [ENSMUST00000139753] [ENSMUST00000146442] [ENSMUST00000147526]
PDB Structure
THE SH3 DOMAIN OF EPS8 EXISTS AS A NOVEL INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 DOMAIN INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 CLOSED MONOMER [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000058210
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052776
Gene: ENSMUSG00000015766
AA Change: S9P

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000100841
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098402
Gene: ENSMUSG00000015766
AA Change: S9P

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111878
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107509
Gene: ENSMUSG00000015766
AA Change: S9P

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132920
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122517
Gene: ENSMUSG00000015766
AA Change: S9P

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
PTB 77 214 8.38e-34 SMART
low complexity region 220 238 N/A INTRINSIC
low complexity region 246 258 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134630
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000139753
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000146442
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119997
Gene: ENSMUSG00000015766
AA Change: S9P

DomainStartEndE-ValueType
PTB 60 188 3.18e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147526
AA Change: S9P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120044
Gene: ENSMUSG00000015766
AA Change: S9P

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 587 4.56e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in resistance to some of the intoxicating effects of ethanol and increased ethanol consumption. NMDA receptor currents and their sensitivity to inhibition by ethanol are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Ifnar1 A G 16: 91,499,556 H315R probably benign Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Eps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Eps8 APN 6 137505479 missense probably benign 0.00
IGL00499:Eps8 APN 6 137522888 nonsense probably null
IGL01587:Eps8 APN 6 137514713 missense probably damaging 1.00
IGL01789:Eps8 APN 6 137539366 missense probably benign 0.01
IGL01836:Eps8 APN 6 137483541 critical splice donor site probably null
IGL01951:Eps8 APN 6 137537671 missense possibly damaging 0.66
IGL02478:Eps8 APN 6 137522842 missense probably benign 0.05
IGL02546:Eps8 APN 6 137479066 missense probably benign 0.30
IGL02861:Eps8 APN 6 137499599 missense probably damaging 1.00
IGL03115:Eps8 APN 6 137527381 missense probably damaging 1.00
IGL03355:Eps8 APN 6 137512145 splice site probably benign
FR4589:Eps8 UTSW 6 137517069 frame shift probably null
R0113:Eps8 UTSW 6 137537684 missense possibly damaging 0.87
R0245:Eps8 UTSW 6 137479128 missense probably benign 0.01
R0462:Eps8 UTSW 6 137514311 missense probably benign 0.00
R0905:Eps8 UTSW 6 137514307 missense probably benign 0.23
R1106:Eps8 UTSW 6 137514324 missense probably damaging 1.00
R1178:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1181:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1448:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1612:Eps8 UTSW 6 137500618 missense probably benign 0.00
R1835:Eps8 UTSW 6 137522279 nonsense probably null
R2068:Eps8 UTSW 6 137522174 missense probably benign 0.13
R2113:Eps8 UTSW 6 137537635 unclassified probably null
R2943:Eps8 UTSW 6 137522872 missense probably damaging 1.00
R3032:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R3879:Eps8 UTSW 6 137527362 splice site probably benign
R3973:Eps8 UTSW 6 137509155 missense probably benign 0.00
R4199:Eps8 UTSW 6 137514327 missense probably damaging 0.96
R4384:Eps8 UTSW 6 137499592 missense probably benign 0.30
R4728:Eps8 UTSW 6 137509162 nonsense probably null
R4840:Eps8 UTSW 6 137527130 missense probably damaging 1.00
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4864:Eps8 UTSW 6 137478969 utr 3 prime probably benign
R5197:Eps8 UTSW 6 137490290 missense probably damaging 0.97
R5197:Eps8 UTSW 6 137490291 missense possibly damaging 0.91
R5214:Eps8 UTSW 6 137527492 missense probably damaging 0.99
R5457:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R5464:Eps8 UTSW 6 137527475 missense probably damaging 1.00
R5557:Eps8 UTSW 6 137479096 missense possibly damaging 0.90
R5981:Eps8 UTSW 6 137482210 missense probably damaging 0.98
R6150:Eps8 UTSW 6 137517174 missense probably damaging 1.00
R6473:Eps8 UTSW 6 137479098 missense probably damaging 1.00
R6529:Eps8 UTSW 6 137514337 missense possibly damaging 0.92
R6574:Eps8 UTSW 6 137483598 nonsense probably null
R6890:Eps8 UTSW 6 137512257 missense probably damaging 0.99
R7180:Eps8 UTSW 6 137479074 missense possibly damaging 0.78
R7314:Eps8 UTSW 6 137527092 missense possibly damaging 0.51
R7336:Eps8 UTSW 6 137509213 missense possibly damaging 0.75
R7784:Eps8 UTSW 6 137499587 missense probably benign 0.01
RF025:Eps8 UTSW 6 137517066 critical splice donor site probably benign
RF028:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF035:Eps8 UTSW 6 137517070 frame shift probably null
RF039:Eps8 UTSW 6 137517070 frame shift probably null
RF046:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF057:Eps8 UTSW 6 137517064 critical splice donor site probably benign
Z1177:Eps8 UTSW 6 137499581 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- ACCACTTCTGAATGACTTAGGAATG -3'
(R):5'- ATTCCTGTGCGTCTGAGTGC -3'

Sequencing Primer
(F):5'- TTGAAACATCATCCCTTGGGAGG -3'
(R):5'- CTTGAAGGCGGAGACCCTTAG -3'
Posted On2019-06-26