Mutagenetix > Incidental Mutation

Incidental Mutation 'R7229:Ncan'

562356

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7229 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70100311 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1090 (F1090L)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002412
AA Change: F1090L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: F1090L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	T	C	14: 54,595,352	E122G	probably benign	Het
Adamts2	T	C	11: 50,791,820	Y880H	probably damaging	Het
Atp13a4	A	G	16: 29,420,905	S830P	probably benign	Het
Atp1a3	T	A	7: 24,987,985	Q696L	probably benign	Het
Brox	G	A	1: 183,291,959	R85*	probably null	Het
C130073F10Rik	T	C	4: 101,890,242	I197V	probably benign	Het
Cand2	G	A	6: 115,791,192	V433M	probably damaging	Het
Cep83	A	G	10: 94,719,665	K74E	probably damaging	Het
Chrng	A	T	1: 87,209,444	T275S	probably benign	Het
Clca2	T	C	3: 145,084,108	D489G	probably damaging	Het
Cmtr1	A	G	17: 29,695,424		probably null	Het
Cnga1	T	C	5: 72,618,249	N43S	probably benign	Het
Cog8	A	T	8: 107,056,352	C102S	probably damaging	Het
Cpsf3	G	A	12: 21,296,737		probably null	Het
Cyp26b1	G	A	6: 84,577,150	Q162*	probably null	Het
Elmod3	A	G	6: 72,594,753	F14S	probably benign	Het
Eps8	A	G	6: 137,539,356	S9P	probably benign	Het
Fam105a	G	A	15: 27,658,187	T199M	probably benign	Het
Fam184b	T	C	5: 45,584,175	Q238R	probably damaging	Het
Fbxw7	T	C	3: 84,977,369	L654S	unknown	Het
Foxp1	A	T	6: 98,935,412	L580Q	unknown	Het
Galr1	A	G	18: 82,405,664	S163P	probably damaging	Het
Ganc	T	C	2: 120,427,775	F201L	possibly damaging	Het
Gin1	T	C	1: 97,785,151	F310L	probably benign	Het
Grik2	A	T	10: 49,101,416		probably null	Het
Haus1	A	T	18: 77,764,134	F94I	probably benign	Het
Hcn4	A	G	9: 58,853,399	Y409C	unknown	Het
Hspa1l	A	G	17: 34,977,255	K90R	probably benign	Het
Icam5	T	C	9: 21,037,001	S702P	possibly damaging	Het
Ifnar1	A	G	16: 91,499,556	H315R	probably benign	Het
Klra9	T	C	6: 130,191,261	H14R	probably damaging	Het
Krt78	A	G	15: 101,947,394	Y661H	probably benign	Het
Krtap11-1	T	C	16: 89,570,925	T69A	possibly damaging	Het
L3mbtl3	C	A	10: 26,292,662	S598I	unknown	Het
Lama1	A	T	17: 67,752,446	D608V		Het
Lrrc55	G	A	2: 85,196,440	T80I	probably damaging	Het
Lyst	A	T	13: 13,643,509	T1255S	probably benign	Het
Magi2	T	C	5: 20,465,588	V310A	probably damaging	Het
Med23	C	A	10: 24,902,004	A750D	probably benign	Het
Mmp2	G	A	8: 92,831,786	R161Q	probably damaging	Het
Myo15	A	T	11: 60,496,495	I733F	probably benign	Het
Olfr701	T	G	7: 106,818,995	V304G	probably damaging	Het
Pafah1b1	A	G	11: 74,682,278	I320T	probably damaging	Het
Pcdhb1	T	A	18: 37,266,687	Y564N	probably damaging	Het
Pear1	A	G	3: 87,750,289	S988P	probably benign	Het
Pgam2	A	C	11: 5,803,013	V194G	probably damaging	Het
Plvap	A	T	8: 71,511,577	I47N	probably damaging	Het
Prdx6	A	T	1: 161,247,297	L71H	probably damaging	Het
Psmb11	G	A	14: 54,625,951	V209M	probably damaging	Het
Ptprn2	G	A	12: 117,227,225		probably null	Het
Rcn2	T	A	9: 56,057,479	N240K	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Slc12a4	T	G	8: 105,946,737	Q734P	probably benign	Het
Smarcc2	T	A	10: 128,488,048	M1085K	unknown	Het
Smg1	A	T	7: 118,176,955	C1371S	probably benign	Het
Spg11	A	T	2: 122,108,104	F456L	probably damaging	Het
Srsf10	C	T	4: 135,856,217		probably benign	Het
Stxbp5	T	C	10: 9,798,187	Y4C	probably damaging	Het
Tdrd12	T	A	7: 35,480,280	D881V	unknown	Het
Tmem171	T	C	13: 98,692,625	T6A	probably benign	Het
Tmem220	T	C	11: 67,026,163	L55P	unknown	Het
Ttn	G	T	2: 76,846,781	P11037Q	unknown	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Usp47	T	C	7: 112,092,877	S849P	probably benign	Het
Vcan	G	A	13: 89,705,270	P524S	possibly damaging	Het
Vmn1r18	A	G	6: 57,390,098	M157T	probably benign	Het
Vmn2r109	A	T	17: 20,540,963	C711S	possibly damaging	Het
Wasf3	C	T	5: 146,455,653	R178C	probably damaging	Het
Wdr76	G	A	2: 121,528,920	V231I	probably damaging	Het
Xirp2	A	T	2: 67,525,551	N3552I	probably damaging	Het
Zfp804a	A	G	2: 82,258,625	T933A	probably benign	Het
Zmynd8	A	G	2: 165,858,053		probably null	Het
Zranb3	A	T	1: 128,040,893	I95K	probably benign	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCCACCAGTGAGTGATTG -3'
(R):5'- AACCTGTGTGAACTGTGTGG -3'

Sequencing Primer
(F):5'- CCCACCAGTGAGTGATTGTTTCATAG -3'
(R):5'- GGTCTCCTGACTCACAAGC -3'

Posted On

2019-06-26