Incidental Mutation 'R7229:Ncan'
ID 562356
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 045301-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7229 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70552961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1090 (F1090L)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000002412
AA Change: F1090L

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: F1090L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,832,809 (GRCm39) E122G probably benign Het
Adamts2 T C 11: 50,682,647 (GRCm39) Y880H probably damaging Het
Atp13a4 A G 16: 29,239,723 (GRCm39) S830P probably benign Het
Atp1a3 T A 7: 24,687,410 (GRCm39) Q696L probably benign Het
Brox G A 1: 183,073,523 (GRCm39) R85* probably null Het
C130073F10Rik T C 4: 101,747,439 (GRCm39) I197V probably benign Het
Cand2 G A 6: 115,768,153 (GRCm39) V433M probably damaging Het
Cep83 A G 10: 94,555,527 (GRCm39) K74E probably damaging Het
Chrng A T 1: 87,137,166 (GRCm39) T275S probably benign Het
Clca3a2 T C 3: 144,789,869 (GRCm39) D489G probably damaging Het
Cmtr1 A G 17: 29,914,398 (GRCm39) probably null Het
Cnga1 T C 5: 72,775,592 (GRCm39) N43S probably benign Het
Cog8 A T 8: 107,782,984 (GRCm39) C102S probably damaging Het
Cpsf3 G A 12: 21,346,738 (GRCm39) probably null Het
Cyp26b1 G A 6: 84,554,132 (GRCm39) Q162* probably null Het
Elmod3 A G 6: 72,571,736 (GRCm39) F14S probably benign Het
Eps8 A G 6: 137,516,354 (GRCm39) S9P probably benign Het
Fam184b T C 5: 45,741,517 (GRCm39) Q238R probably damaging Het
Fbxw7 T C 3: 84,884,676 (GRCm39) L654S unknown Het
Foxp1 A T 6: 98,912,373 (GRCm39) L580Q unknown Het
Galr1 A G 18: 82,423,789 (GRCm39) S163P probably damaging Het
Ganc T C 2: 120,258,256 (GRCm39) F201L possibly damaging Het
Gin1 T C 1: 97,712,876 (GRCm39) F310L probably benign Het
Grik2 A T 10: 48,977,512 (GRCm39) probably null Het
Haus1 A T 18: 77,851,834 (GRCm39) F94I probably benign Het
Hcn4 A G 9: 58,760,682 (GRCm39) Y409C unknown Het
Hspa1l A G 17: 35,196,231 (GRCm39) K90R probably benign Het
Icam5 T C 9: 20,948,297 (GRCm39) S702P possibly damaging Het
Ifnar1 A G 16: 91,296,444 (GRCm39) H315R probably benign Het
Klra9 T C 6: 130,168,224 (GRCm39) H14R probably damaging Het
Krt78 A G 15: 101,855,829 (GRCm39) Y661H probably benign Het
Krtap11-1 T C 16: 89,367,813 (GRCm39) T69A possibly damaging Het
L3mbtl3 C A 10: 26,168,560 (GRCm39) S598I unknown Het
Lama1 A T 17: 68,059,441 (GRCm39) D608V Het
Lrrc55 G A 2: 85,026,784 (GRCm39) T80I probably damaging Het
Lyst A T 13: 13,818,094 (GRCm39) T1255S probably benign Het
Magi2 T C 5: 20,670,586 (GRCm39) V310A probably damaging Het
Med23 C A 10: 24,777,902 (GRCm39) A750D probably benign Het
Mmp2 G A 8: 93,558,414 (GRCm39) R161Q probably damaging Het
Myo15a A T 11: 60,387,321 (GRCm39) I733F probably benign Het
Or2ag2b T G 7: 106,418,202 (GRCm39) V304G probably damaging Het
Otulinl G A 15: 27,658,273 (GRCm39) T199M probably benign Het
Pafah1b1 A G 11: 74,573,104 (GRCm39) I320T probably damaging Het
Pcdhb1 T A 18: 37,399,740 (GRCm39) Y564N probably damaging Het
Pear1 A G 3: 87,657,596 (GRCm39) S988P probably benign Het
Pgam2 A C 11: 5,753,013 (GRCm39) V194G probably damaging Het
Plvap A T 8: 71,964,221 (GRCm39) I47N probably damaging Het
Prdx6 A T 1: 161,074,867 (GRCm39) L71H probably damaging Het
Psmb11 G A 14: 54,863,408 (GRCm39) V209M probably damaging Het
Ptprn2 G A 12: 117,190,845 (GRCm39) probably null Het
Rcn2 T A 9: 55,964,763 (GRCm39) N240K probably benign Het
Rsad2 A T 12: 26,504,122 (GRCm39) Y136N probably damaging Het
Slc12a4 T G 8: 106,673,369 (GRCm39) Q734P probably benign Het
Smarcc2 T A 10: 128,323,917 (GRCm39) M1085K unknown Het
Smg1 A T 7: 117,776,178 (GRCm39) C1371S probably benign Het
Spg11 A T 2: 121,938,585 (GRCm39) F456L probably damaging Het
Srsf10 C T 4: 135,583,528 (GRCm39) probably benign Het
Stxbp5 T C 10: 9,673,931 (GRCm39) Y4C probably damaging Het
Tdrd12 T A 7: 35,179,705 (GRCm39) D881V unknown Het
Tmem171 T C 13: 98,829,133 (GRCm39) T6A probably benign Het
Tmem220 T C 11: 66,916,989 (GRCm39) L55P unknown Het
Ttn G T 2: 76,677,125 (GRCm39) P11037Q unknown Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Usp47 T C 7: 111,692,084 (GRCm39) S849P probably benign Het
Vcan G A 13: 89,853,389 (GRCm39) P524S possibly damaging Het
Vmn1r18 A G 6: 57,367,083 (GRCm39) M157T probably benign Het
Vmn2r109 A T 17: 20,761,225 (GRCm39) C711S possibly damaging Het
Wasf3 C T 5: 146,392,463 (GRCm39) R178C probably damaging Het
Wdr76 G A 2: 121,359,401 (GRCm39) V231I probably damaging Het
Xirp2 A T 2: 67,355,895 (GRCm39) N3552I probably damaging Het
Zfp804a A G 2: 82,088,969 (GRCm39) T933A probably benign Het
Zmynd8 A G 2: 165,699,973 (GRCm39) probably null Het
Zranb3 A T 1: 127,968,630 (GRCm39) I95K probably benign Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCACCAGTGAGTGATTG -3'
(R):5'- AACCTGTGTGAACTGTGTGG -3'

Sequencing Primer
(F):5'- CCCACCAGTGAGTGATTGTTTCATAG -3'
(R):5'- GGTCTCCTGACTCACAAGC -3'
Posted On 2019-06-26