Mutagenetix > Incidental Mutation

Incidental Mutation 'R7229:Stxbp5'

562364

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7229 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9798187 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 4 (Y4C)

Ref Sequence

ENSEMBL: ENSMUSP00000123355 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000136324] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

probably damaging
Transcript: ENSMUST00000038213
AA Change: Y673C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: Y673C

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000125200
AA Change: Y673C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: Y673C

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000136324
AA Change: Y4C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123355
Gene: ENSMUSG00000019790
AA Change: Y4C

Domain	Start	End	E-Value	Type
low complexity region	98	106	N/A	INTRINSIC
low complexity region	209	230	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000141722
AA Change: Y673C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: Y673C

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	T	C	14: 54,595,352	E122G	probably benign	Het
Adamts2	T	C	11: 50,791,820	Y880H	probably damaging	Het
Atp13a4	A	G	16: 29,420,905	S830P	probably benign	Het
Atp1a3	T	A	7: 24,987,985	Q696L	probably benign	Het
Brox	G	A	1: 183,291,959	R85*	probably null	Het
C130073F10Rik	T	C	4: 101,890,242	I197V	probably benign	Het
Cand2	G	A	6: 115,791,192	V433M	probably damaging	Het
Cep83	A	G	10: 94,719,665	K74E	probably damaging	Het
Chrng	A	T	1: 87,209,444	T275S	probably benign	Het
Clca2	T	C	3: 145,084,108	D489G	probably damaging	Het
Cmtr1	A	G	17: 29,695,424		probably null	Het
Cnga1	T	C	5: 72,618,249	N43S	probably benign	Het
Cog8	A	T	8: 107,056,352	C102S	probably damaging	Het
Cpsf3	G	A	12: 21,296,737		probably null	Het
Cyp26b1	G	A	6: 84,577,150	Q162*	probably null	Het
Elmod3	A	G	6: 72,594,753	F14S	probably benign	Het
Eps8	A	G	6: 137,539,356	S9P	probably benign	Het
Fam105a	G	A	15: 27,658,187	T199M	probably benign	Het
Fam184b	T	C	5: 45,584,175	Q238R	probably damaging	Het
Fbxw7	T	C	3: 84,977,369	L654S	unknown	Het
Foxp1	A	T	6: 98,935,412	L580Q	unknown	Het
Galr1	A	G	18: 82,405,664	S163P	probably damaging	Het
Ganc	T	C	2: 120,427,775	F201L	possibly damaging	Het
Gin1	T	C	1: 97,785,151	F310L	probably benign	Het
Grik2	A	T	10: 49,101,416		probably null	Het
Haus1	A	T	18: 77,764,134	F94I	probably benign	Het
Hcn4	A	G	9: 58,853,399	Y409C	unknown	Het
Hspa1l	A	G	17: 34,977,255	K90R	probably benign	Het
Icam5	T	C	9: 21,037,001	S702P	possibly damaging	Het
Ifnar1	A	G	16: 91,499,556	H315R	probably benign	Het
Klra9	T	C	6: 130,191,261	H14R	probably damaging	Het
Krt78	A	G	15: 101,947,394	Y661H	probably benign	Het
Krtap11-1	T	C	16: 89,570,925	T69A	possibly damaging	Het
L3mbtl3	C	A	10: 26,292,662	S598I	unknown	Het
Lama1	A	T	17: 67,752,446	D608V		Het
Lrrc55	G	A	2: 85,196,440	T80I	probably damaging	Het
Lyst	A	T	13: 13,643,509	T1255S	probably benign	Het
Magi2	T	C	5: 20,465,588	V310A	probably damaging	Het
Med23	C	A	10: 24,902,004	A750D	probably benign	Het
Mmp2	G	A	8: 92,831,786	R161Q	probably damaging	Het
Myo15	A	T	11: 60,496,495	I733F	probably benign	Het
Ncan	A	T	8: 70,100,311	F1090L	possibly damaging	Het
Olfr701	T	G	7: 106,818,995	V304G	probably damaging	Het
Pafah1b1	A	G	11: 74,682,278	I320T	probably damaging	Het
Pcdhb1	T	A	18: 37,266,687	Y564N	probably damaging	Het
Pear1	A	G	3: 87,750,289	S988P	probably benign	Het
Pgam2	A	C	11: 5,803,013	V194G	probably damaging	Het
Plvap	A	T	8: 71,511,577	I47N	probably damaging	Het
Prdx6	A	T	1: 161,247,297	L71H	probably damaging	Het
Psmb11	G	A	14: 54,625,951	V209M	probably damaging	Het
Ptprn2	G	A	12: 117,227,225		probably null	Het
Rcn2	T	A	9: 56,057,479	N240K	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Slc12a4	T	G	8: 105,946,737	Q734P	probably benign	Het
Smarcc2	T	A	10: 128,488,048	M1085K	unknown	Het
Smg1	A	T	7: 118,176,955	C1371S	probably benign	Het
Spg11	A	T	2: 122,108,104	F456L	probably damaging	Het
Srsf10	C	T	4: 135,856,217		probably benign	Het
Tdrd12	T	A	7: 35,480,280	D881V	unknown	Het
Tmem171	T	C	13: 98,692,625	T6A	probably benign	Het
Tmem220	T	C	11: 67,026,163	L55P	unknown	Het
Ttn	G	T	2: 76,846,781	P11037Q	unknown	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Usp47	T	C	7: 112,092,877	S849P	probably benign	Het
Vcan	G	A	13: 89,705,270	P524S	possibly damaging	Het
Vmn1r18	A	G	6: 57,390,098	M157T	probably benign	Het
Vmn2r109	A	T	17: 20,540,963	C711S	possibly damaging	Het
Wasf3	C	T	5: 146,455,653	R178C	probably damaging	Het
Wdr76	G	A	2: 121,528,920	V231I	probably damaging	Het
Xirp2	A	T	2: 67,525,551	N3552I	probably damaging	Het
Zfp804a	A	G	2: 82,258,625	T933A	probably benign	Het
Zmynd8	A	G	2: 165,858,053		probably null	Het
Zranb3	A	T	1: 128,040,893	I95K	probably benign	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGGTTGTTCAGTTCAGGTCACC -3'
(R):5'- ACCTCCATATGTGAGCTCCAC -3'

Sequencing Primer
(F):5'- ACCTGGGCTGCTGTTTTTAC -3'
(R):5'- GTGAGCTCCACATAACACAGTACATG -3'

Posted On

2019-06-26