Incidental Mutation 'R7229:Ifnar1'
ID 562385
Institutional Source Beutler Lab
Gene Symbol Ifnar1
Ensembl Gene ENSMUSG00000022967
Gene Name interferon (alpha and beta) receptor 1
Synonyms Ifar, Ifrc, IFN-alpha/betaR
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010508; VEGA:  OTTMUST00000067225; MGI: 107658;

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7229 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 91485238-91507441 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91499556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 315 (H315R)
Ref Sequence ENSEMBL: ENSMUSP00000023689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023689] [ENSMUST00000117748] [ENSMUST00000123196] [ENSMUST00000129878] [ENSMUST00000232509]
AlphaFold P33896
PDB Structure Murine Ifnar1 in complex with interferon-beta [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023689
AA Change: H315R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023689
Gene: ENSMUSG00000022967
AA Change: H315R

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117748
AA Change: H315R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112670
Gene: ENSMUSG00000022967
AA Change: H315R

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123196
SMART Domains Protein: ENSMUSP00000119160
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129878
SMART Domains Protein: ENSMUSP00000120945
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232509
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased susceptibility to viral infection, elevated levels of myeloid lineage cells in the peripheral blood and bone marrow, and reduced immune response to immunostimulatory DNA. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(5) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,595,352 E122G probably benign Het
Adamts2 T C 11: 50,791,820 Y880H probably damaging Het
Atp13a4 A G 16: 29,420,905 S830P probably benign Het
Atp1a3 T A 7: 24,987,985 Q696L probably benign Het
Brox G A 1: 183,291,959 R85* probably null Het
C130073F10Rik T C 4: 101,890,242 I197V probably benign Het
Cand2 G A 6: 115,791,192 V433M probably damaging Het
Cep83 A G 10: 94,719,665 K74E probably damaging Het
Chrng A T 1: 87,209,444 T275S probably benign Het
Clca2 T C 3: 145,084,108 D489G probably damaging Het
Cmtr1 A G 17: 29,695,424 probably null Het
Cnga1 T C 5: 72,618,249 N43S probably benign Het
Cog8 A T 8: 107,056,352 C102S probably damaging Het
Cpsf3 G A 12: 21,296,737 probably null Het
Cyp26b1 G A 6: 84,577,150 Q162* probably null Het
Elmod3 A G 6: 72,594,753 F14S probably benign Het
Eps8 A G 6: 137,539,356 S9P probably benign Het
Fam105a G A 15: 27,658,187 T199M probably benign Het
Fam184b T C 5: 45,584,175 Q238R probably damaging Het
Fbxw7 T C 3: 84,977,369 L654S unknown Het
Foxp1 A T 6: 98,935,412 L580Q unknown Het
Galr1 A G 18: 82,405,664 S163P probably damaging Het
Ganc T C 2: 120,427,775 F201L possibly damaging Het
Gin1 T C 1: 97,785,151 F310L probably benign Het
Grik2 A T 10: 49,101,416 probably null Het
Haus1 A T 18: 77,764,134 F94I probably benign Het
Hcn4 A G 9: 58,853,399 Y409C unknown Het
Hspa1l A G 17: 34,977,255 K90R probably benign Het
Icam5 T C 9: 21,037,001 S702P possibly damaging Het
Klra9 T C 6: 130,191,261 H14R probably damaging Het
Krt78 A G 15: 101,947,394 Y661H probably benign Het
Krtap11-1 T C 16: 89,570,925 T69A possibly damaging Het
L3mbtl3 C A 10: 26,292,662 S598I unknown Het
Lama1 A T 17: 67,752,446 D608V Het
Lrrc55 G A 2: 85,196,440 T80I probably damaging Het
Lyst A T 13: 13,643,509 T1255S probably benign Het
Magi2 T C 5: 20,465,588 V310A probably damaging Het
Med23 C A 10: 24,902,004 A750D probably benign Het
Mmp2 G A 8: 92,831,786 R161Q probably damaging Het
Myo15 A T 11: 60,496,495 I733F probably benign Het
Ncan A T 8: 70,100,311 F1090L possibly damaging Het
Olfr701 T G 7: 106,818,995 V304G probably damaging Het
Pafah1b1 A G 11: 74,682,278 I320T probably damaging Het
Pcdhb1 T A 18: 37,266,687 Y564N probably damaging Het
Pear1 A G 3: 87,750,289 S988P probably benign Het
Pgam2 A C 11: 5,803,013 V194G probably damaging Het
Plvap A T 8: 71,511,577 I47N probably damaging Het
Prdx6 A T 1: 161,247,297 L71H probably damaging Het
Psmb11 G A 14: 54,625,951 V209M probably damaging Het
Ptprn2 G A 12: 117,227,225 probably null Het
Rcn2 T A 9: 56,057,479 N240K probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Slc12a4 T G 8: 105,946,737 Q734P probably benign Het
Smarcc2 T A 10: 128,488,048 M1085K unknown Het
Smg1 A T 7: 118,176,955 C1371S probably benign Het
Spg11 A T 2: 122,108,104 F456L probably damaging Het
Srsf10 C T 4: 135,856,217 probably benign Het
Stxbp5 T C 10: 9,798,187 Y4C probably damaging Het
Tdrd12 T A 7: 35,480,280 D881V unknown Het
Tmem171 T C 13: 98,692,625 T6A probably benign Het
Tmem220 T C 11: 67,026,163 L55P unknown Het
Ttn G T 2: 76,846,781 P11037Q unknown Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp47 T C 7: 112,092,877 S849P probably benign Het
Vcan G A 13: 89,705,270 P524S possibly damaging Het
Vmn1r18 A G 6: 57,390,098 M157T probably benign Het
Vmn2r109 A T 17: 20,540,963 C711S possibly damaging Het
Wasf3 C T 5: 146,455,653 R178C probably damaging Het
Wdr76 G A 2: 121,528,920 V231I probably damaging Het
Xirp2 A T 2: 67,525,551 N3552I probably damaging Het
Zfp804a A G 2: 82,258,625 T933A probably benign Het
Zmynd8 A G 2: 165,858,053 probably null Het
Zranb3 A T 1: 128,040,893 I95K probably benign Het
Other mutations in Ifnar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ifnar1 APN 16 91489782 missense probably damaging 0.99
IGL02183:Ifnar1 APN 16 91505146 missense possibly damaging 0.94
IGL02828:Ifnar1 APN 16 91505416 critical splice donor site probably null
macro-1 UTSW 16 91499885 missense probably damaging 0.98
shook UTSW 16 91499537 nonsense probably null
sneffels UTSW 16 91501620 critical splice acceptor site probably null
R0124:Ifnar1 UTSW 16 91499537 nonsense probably null
R0502:Ifnar1 UTSW 16 91501751 missense probably damaging 1.00
R0617:Ifnar1 UTSW 16 91501682 missense probably damaging 1.00
R1509:Ifnar1 UTSW 16 91503496 missense probably damaging 1.00
R4111:Ifnar1 UTSW 16 91496158 missense probably damaging 1.00
R4473:Ifnar1 UTSW 16 91495170 missense probably damaging 0.98
R4964:Ifnar1 UTSW 16 91505086 missense probably benign 0.08
R5497:Ifnar1 UTSW 16 91505364 missense probably benign 0.01
R6135:Ifnar1 UTSW 16 91501620 critical splice acceptor site probably null
R6398:Ifnar1 UTSW 16 91505415 critical splice donor site probably null
R6505:Ifnar1 UTSW 16 91499537 nonsense probably null
R6620:Ifnar1 UTSW 16 91496267 splice site probably null
R7664:Ifnar1 UTSW 16 91495194 missense probably damaging 1.00
R8337:Ifnar1 UTSW 16 91505336 missense possibly damaging 0.70
R8348:Ifnar1 UTSW 16 91495299 missense probably benign 0.00
R8531:Ifnar1 UTSW 16 91495456 nonsense probably null
R8683:Ifnar1 UTSW 16 91499444 missense probably damaging 1.00
R9031:Ifnar1 UTSW 16 91505191 missense probably benign 0.13
R9110:Ifnar1 UTSW 16 91505262 missense probably benign 0.04
R9278:Ifnar1 UTSW 16 91505125 missense probably damaging 1.00
R9356:Ifnar1 UTSW 16 91495479 missense probably benign 0.06
R9359:Ifnar1 UTSW 16 91495479 missense probably benign 0.06
R9388:Ifnar1 UTSW 16 91495479 missense probably benign 0.06
X0057:Ifnar1 UTSW 16 91495424 missense probably damaging 0.98
X0057:Ifnar1 UTSW 16 91505283 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGCTTACTACAGTGTCTTAGG -3'
(R):5'- ACACTCCAGAAAGCGCTTGC -3'

Sequencing Primer
(F):5'- CAGTGTCTTAGGTATTATAGAGCCTC -3'
(R):5'- CTATACAGCAGGCATGGACC -3'
Posted On 2019-06-26