Incidental Mutation 'R7229:Vmn2r109'
ID 562387
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 045301-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7229 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20760779-20785018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20761225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 711 (C711S)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect possibly damaging
Transcript: ENSMUST00000167093
AA Change: C711S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: C711S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,832,809 (GRCm39) E122G probably benign Het
Adamts2 T C 11: 50,682,647 (GRCm39) Y880H probably damaging Het
Atp13a4 A G 16: 29,239,723 (GRCm39) S830P probably benign Het
Atp1a3 T A 7: 24,687,410 (GRCm39) Q696L probably benign Het
Brox G A 1: 183,073,523 (GRCm39) R85* probably null Het
C130073F10Rik T C 4: 101,747,439 (GRCm39) I197V probably benign Het
Cand2 G A 6: 115,768,153 (GRCm39) V433M probably damaging Het
Cep83 A G 10: 94,555,527 (GRCm39) K74E probably damaging Het
Chrng A T 1: 87,137,166 (GRCm39) T275S probably benign Het
Clca3a2 T C 3: 144,789,869 (GRCm39) D489G probably damaging Het
Cmtr1 A G 17: 29,914,398 (GRCm39) probably null Het
Cnga1 T C 5: 72,775,592 (GRCm39) N43S probably benign Het
Cog8 A T 8: 107,782,984 (GRCm39) C102S probably damaging Het
Cpsf3 G A 12: 21,346,738 (GRCm39) probably null Het
Cyp26b1 G A 6: 84,554,132 (GRCm39) Q162* probably null Het
Elmod3 A G 6: 72,571,736 (GRCm39) F14S probably benign Het
Eps8 A G 6: 137,516,354 (GRCm39) S9P probably benign Het
Fam184b T C 5: 45,741,517 (GRCm39) Q238R probably damaging Het
Fbxw7 T C 3: 84,884,676 (GRCm39) L654S unknown Het
Foxp1 A T 6: 98,912,373 (GRCm39) L580Q unknown Het
Galr1 A G 18: 82,423,789 (GRCm39) S163P probably damaging Het
Ganc T C 2: 120,258,256 (GRCm39) F201L possibly damaging Het
Gin1 T C 1: 97,712,876 (GRCm39) F310L probably benign Het
Grik2 A T 10: 48,977,512 (GRCm39) probably null Het
Haus1 A T 18: 77,851,834 (GRCm39) F94I probably benign Het
Hcn4 A G 9: 58,760,682 (GRCm39) Y409C unknown Het
Hspa1l A G 17: 35,196,231 (GRCm39) K90R probably benign Het
Icam5 T C 9: 20,948,297 (GRCm39) S702P possibly damaging Het
Ifnar1 A G 16: 91,296,444 (GRCm39) H315R probably benign Het
Klra9 T C 6: 130,168,224 (GRCm39) H14R probably damaging Het
Krt78 A G 15: 101,855,829 (GRCm39) Y661H probably benign Het
Krtap11-1 T C 16: 89,367,813 (GRCm39) T69A possibly damaging Het
L3mbtl3 C A 10: 26,168,560 (GRCm39) S598I unknown Het
Lama1 A T 17: 68,059,441 (GRCm39) D608V Het
Lrrc55 G A 2: 85,026,784 (GRCm39) T80I probably damaging Het
Lyst A T 13: 13,818,094 (GRCm39) T1255S probably benign Het
Magi2 T C 5: 20,670,586 (GRCm39) V310A probably damaging Het
Med23 C A 10: 24,777,902 (GRCm39) A750D probably benign Het
Mmp2 G A 8: 93,558,414 (GRCm39) R161Q probably damaging Het
Myo15a A T 11: 60,387,321 (GRCm39) I733F probably benign Het
Ncan A T 8: 70,552,961 (GRCm39) F1090L possibly damaging Het
Or2ag2b T G 7: 106,418,202 (GRCm39) V304G probably damaging Het
Otulinl G A 15: 27,658,273 (GRCm39) T199M probably benign Het
Pafah1b1 A G 11: 74,573,104 (GRCm39) I320T probably damaging Het
Pcdhb1 T A 18: 37,399,740 (GRCm39) Y564N probably damaging Het
Pear1 A G 3: 87,657,596 (GRCm39) S988P probably benign Het
Pgam2 A C 11: 5,753,013 (GRCm39) V194G probably damaging Het
Plvap A T 8: 71,964,221 (GRCm39) I47N probably damaging Het
Prdx6 A T 1: 161,074,867 (GRCm39) L71H probably damaging Het
Psmb11 G A 14: 54,863,408 (GRCm39) V209M probably damaging Het
Ptprn2 G A 12: 117,190,845 (GRCm39) probably null Het
Rcn2 T A 9: 55,964,763 (GRCm39) N240K probably benign Het
Rsad2 A T 12: 26,504,122 (GRCm39) Y136N probably damaging Het
Slc12a4 T G 8: 106,673,369 (GRCm39) Q734P probably benign Het
Smarcc2 T A 10: 128,323,917 (GRCm39) M1085K unknown Het
Smg1 A T 7: 117,776,178 (GRCm39) C1371S probably benign Het
Spg11 A T 2: 121,938,585 (GRCm39) F456L probably damaging Het
Srsf10 C T 4: 135,583,528 (GRCm39) probably benign Het
Stxbp5 T C 10: 9,673,931 (GRCm39) Y4C probably damaging Het
Tdrd12 T A 7: 35,179,705 (GRCm39) D881V unknown Het
Tmem171 T C 13: 98,829,133 (GRCm39) T6A probably benign Het
Tmem220 T C 11: 66,916,989 (GRCm39) L55P unknown Het
Ttn G T 2: 76,677,125 (GRCm39) P11037Q unknown Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Usp47 T C 7: 111,692,084 (GRCm39) S849P probably benign Het
Vcan G A 13: 89,853,389 (GRCm39) P524S possibly damaging Het
Vmn1r18 A G 6: 57,367,083 (GRCm39) M157T probably benign Het
Wasf3 C T 5: 146,392,463 (GRCm39) R178C probably damaging Het
Wdr76 G A 2: 121,359,401 (GRCm39) V231I probably damaging Het
Xirp2 A T 2: 67,355,895 (GRCm39) N3552I probably damaging Het
Zfp804a A G 2: 82,088,969 (GRCm39) T933A probably benign Het
Zmynd8 A G 2: 165,699,973 (GRCm39) probably null Het
Zranb3 A T 1: 127,968,630 (GRCm39) I95K probably benign Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20,770,419 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20,761,383 (GRCm39) missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20,761,671 (GRCm39) missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20,774,654 (GRCm39) missense probably benign
IGL01864:Vmn2r109 APN 17 20,761,396 (GRCm39) missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20,761,342 (GRCm39) missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20,774,603 (GRCm39) missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20,774,422 (GRCm39) missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20,761,150 (GRCm39) missense probably benign
IGL02490:Vmn2r109 APN 17 20,761,246 (GRCm39) missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20,760,963 (GRCm39) missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20,774,518 (GRCm39) missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20,774,062 (GRCm39) missense probably benign
IGL02745:Vmn2r109 APN 17 20,761,512 (GRCm39) missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20,774,839 (GRCm39) critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20,773,148 (GRCm39) missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20,760,937 (GRCm39) missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20,761,670 (GRCm39) nonsense probably null
R0882:Vmn2r109 UTSW 17 20,774,842 (GRCm39) splice site probably benign
R1241:Vmn2r109 UTSW 17 20,775,503 (GRCm39) missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20,761,002 (GRCm39) missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20,774,072 (GRCm39) nonsense probably null
R1957:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20,774,185 (GRCm39) missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20,761,448 (GRCm39) nonsense probably null
R2073:Vmn2r109 UTSW 17 20,784,974 (GRCm39) missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20,774,798 (GRCm39) missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20,761,248 (GRCm39) missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20,774,704 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20,774,074 (GRCm39) missense probably benign
R4428:Vmn2r109 UTSW 17 20,773,286 (GRCm39) missense probably benign
R4584:Vmn2r109 UTSW 17 20,774,820 (GRCm39) nonsense probably null
R4652:Vmn2r109 UTSW 17 20,761,656 (GRCm39) missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20,761,605 (GRCm39) missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20,774,153 (GRCm39) missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20,761,494 (GRCm39) missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20,770,348 (GRCm39) missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20,775,451 (GRCm39) missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20,774,603 (GRCm39) missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20,761,189 (GRCm39) missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20,760,933 (GRCm39) missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20,760,781 (GRCm39) makesense probably null
R5702:Vmn2r109 UTSW 17 20,774,407 (GRCm39) missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20,774,567 (GRCm39) missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20,773,121 (GRCm39) missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20,761,318 (GRCm39) missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20,760,981 (GRCm39) missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20,761,440 (GRCm39) missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20,784,796 (GRCm39) critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20,774,785 (GRCm39) missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20,760,932 (GRCm39) missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20,760,973 (GRCm39) missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20,785,006 (GRCm39) missense probably benign 0.03
R7238:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20,760,945 (GRCm39) missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20,761,700 (GRCm39) missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20,761,043 (GRCm39) missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20,761,536 (GRCm39) missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20,774,665 (GRCm39) missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20,760,942 (GRCm39) missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20,773,117 (GRCm39) missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20,761,436 (GRCm39) missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20,760,782 (GRCm39) missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20,774,729 (GRCm39) missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20,774,531 (GRCm39) missense possibly damaging 0.96
R9687:Vmn2r109 UTSW 17 20,775,332 (GRCm39) missense
Z1176:Vmn2r109 UTSW 17 20,773,256 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACCAGCATGCTGAATGACAG -3'
(R):5'- CCTTCAGCAGACCATATTTGGAG -3'

Sequencing Primer
(F):5'- TCAGGCAGATTTCTAGATAGGAATGC -3'
(R):5'- GCAGACCATATTTGGAGTTTCATTC -3'
Posted On 2019-06-26