Incidental Mutation 'R0576:Nrde2'
ID56239
Institutional Source Beutler Lab
Gene Symbol Nrde2
Ensembl Gene ENSMUSG00000021179
Gene Namenrde-2 necessary for RNA interference, domain containing
Synonyms
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0576 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location100125452-100159653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100132233 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 725 (V725A)
Ref Sequence ENSEMBL: ENSMUSP00000021596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021596]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021596
AA Change: V725A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021596
Gene: ENSMUSG00000021179
AA Change: V725A

DomainStartEndE-ValueType
low complexity region 85 107 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
Pfam:NRDE-2 318 658 1.2e-107 PFAM
Blast:HAT 765 800 2e-10 BLAST
Blast:HAT 802 841 3e-16 BLAST
Blast:HAT 986 1018 3e-10 BLAST
Blast:HAT 1075 1109 1e-14 BLAST
Blast:HAT 1111 1143 8e-15 BLAST
low complexity region 1154 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223314
Meta Mutation Damage Score 0.3711 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Nrde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Nrde2 APN 12 100130931 missense probably benign 0.01
IGL02697:Nrde2 APN 12 100131207 missense probably damaging 1.00
IGL02798:Nrde2 APN 12 100143822 nonsense probably null
IGL02810:Nrde2 APN 12 100143758 missense possibly damaging 0.81
IGL02814:Nrde2 APN 12 100144135 missense probably null 0.80
IGL02990:Nrde2 APN 12 100142096 missense probably damaging 1.00
kurtz UTSW 12 100134405 missense possibly damaging 0.92
R0090:Nrde2 UTSW 12 100129286 splice site probably benign
R0646:Nrde2 UTSW 12 100143846 nonsense probably null
R1130:Nrde2 UTSW 12 100125670 missense probably damaging 0.97
R1216:Nrde2 UTSW 12 100149810 splice site probably benign
R1661:Nrde2 UTSW 12 100149860 missense probably benign 0.19
R2069:Nrde2 UTSW 12 100142232 missense probably damaging 1.00
R4405:Nrde2 UTSW 12 100130584 missense probably benign 0.01
R4422:Nrde2 UTSW 12 100146027 nonsense probably null
R5169:Nrde2 UTSW 12 100129293 critical splice donor site probably null
R5200:Nrde2 UTSW 12 100130497 missense possibly damaging 0.77
R5338:Nrde2 UTSW 12 100130778 missense probably damaging 1.00
R5512:Nrde2 UTSW 12 100142250 missense probably benign 0.20
R5820:Nrde2 UTSW 12 100132287 missense probably benign 0.00
R6019:Nrde2 UTSW 12 100132242 missense probably benign 0.04
R6346:Nrde2 UTSW 12 100132306 missense probably benign 0.01
R6378:Nrde2 UTSW 12 100130757 missense probably damaging 0.99
R6479:Nrde2 UTSW 12 100143948 missense probably benign 0.00
R6523:Nrde2 UTSW 12 100134405 missense possibly damaging 0.92
R7073:Nrde2 UTSW 12 100132488 missense probably benign 0.00
R7220:Nrde2 UTSW 12 100130919 missense probably benign 0.05
R7412:Nrde2 UTSW 12 100142250 nonsense probably null
R7505:Nrde2 UTSW 12 100132498 missense probably benign 0.15
R7699:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7700:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7733:Nrde2 UTSW 12 100144140 missense possibly damaging 0.92
R7868:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R7951:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R8131:Nrde2 UTSW 12 100142243 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCCGGATAATCACAGACGACAG -3'
(R):5'- ACGAGAGCAGCATCTTTGAGAGTG -3'

Sequencing Primer
(F):5'- TCTGAAGTGACTACCAGCGTC -3'
(R):5'- GAGTGAACTTTATGATGAAAAGCCCC -3'
Posted On2013-07-11