Mutagenetix > Incidental Mutation

Incidental Mutation 'R7230:F5'

562398

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000026579

Gene Name

coagulation factor V

Synonyms

Cf-5, Cf5

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7230 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

164151838-164220277 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 164184953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 479 (F479L)

Ref Sequence

ENSEMBL: ENSMUSP00000083204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086040]

AlphaFold

O88783

Predicted Effect

probably benign
Transcript: ENSMUST00000086040
AA Change: F479L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: F479L

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
Pfam:Cu-oxidase_3	67	196	4.4e-10	PFAM
low complexity region	282	300	N/A	INTRINSIC
Pfam:Cu-oxidase_3	397	527	1.5e-7	PFAM
low complexity region	1013	1019	N/A	INTRINSIC
low complexity region	1045	1058	N/A	INTRINSIC
low complexity region	1156	1173	N/A	INTRINSIC
low complexity region	1352	1366	N/A	INTRINSIC
low complexity region	1368	1382	N/A	INTRINSIC
low complexity region	1440	1464	N/A	INTRINSIC
Pfam:Cu-oxidase_3	1600	1714	9.1e-8	PFAM
FA58C	1865	2020	8.03e-36	SMART
FA58C	2024	2180	1.96e-30	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	C	7: 46,117,388	D989E	probably benign	Het
Adad1	A	G	3: 37,065,166	Y132C	probably damaging	Het
Adam33	A	T	2: 131,053,563	C579S	probably damaging	Het
Adam6a	A	C	12: 113,545,582	Q525P	probably damaging	Het
Alpk3	C	T	7: 81,093,294	P953L	probably damaging	Het
Atat1	A	G	17: 35,909,439	S54P	probably damaging	Het
Bpgm	A	G	6: 34,487,567	E73G	possibly damaging	Het
Cab39	T	A	1: 85,848,159		probably null	Het
Ccdc162	A	G	10: 41,678,813	L285P	probably damaging	Het
Ccdc30	T	C	4: 119,339,782	E429G	possibly damaging	Het
Cct3	C	T	3: 88,313,260	R260W	probably damaging	Het
Chd1	C	A	17: 15,706,937		probably null	Het
Cxcr4	T	G	1: 128,589,790	T45P	probably damaging	Het
Disp2	G	T	2: 118,791,805	R1006L	probably damaging	Het
Dlec1	T	G	9: 119,124,538		probably null	Het
Dram2	T	G	3: 106,572,978	Y202*	probably null	Het
Etl4	C	A	2: 20,797,988	T1035K	probably damaging	Het
Fam172a	G	A	13: 77,759,472	E5K	probably damaging	Het
Frrs1l	C	A	4: 56,972,372	G110W	probably damaging	Het
Gpbp1l1	T	A	4: 116,588,610	I303N	probably damaging	Het
Grik5	A	G	7: 25,023,070	F538S	probably damaging	Het
Hgsnat	C	A	8: 25,954,832		probably null	Het
Hs2st1	T	C	3: 144,434,546	D338G	probably benign	Het
Impdh1	T	C	6: 29,206,063		probably null	Het
Ipo9	T	C	1: 135,406,758		probably benign	Het
Kdm4b	T	G	17: 56,369,155	L220R	probably damaging	Het
Map1a	T	A	2: 121,300,818	F705Y	probably damaging	Het
Med22	C	T	2: 26,908,211	D99N	probably benign	Het
Muc6	T	C	7: 141,649,214	Y519C	probably damaging	Het
Myt1l	A	G	12: 29,783,874	I25M	probably damaging	Het
Ncam1	T	A	9: 49,509,823	I731F	probably benign	Het
Nlrp4f	T	A	13: 65,194,901	H310L	probably benign	Het
Olfr1286	A	T	2: 111,420,916	F12I	probably damaging	Het
Olfr1306	T	A	2: 111,912,561	Y123F	probably damaging	Het
Olfr694	A	T	7: 106,689,524	M69K	possibly damaging	Het
Olfr701	C	A	7: 106,818,179	T32K	possibly damaging	Het
Prl8a6	T	A	13: 27,433,038	Y223F	probably benign	Het
Prss39	A	G	1: 34,502,147	D244G	probably damaging	Het
Ptx4	A	T	17: 25,123,103	Q184L	possibly damaging	Het
Slc26a1	A	T	5: 108,671,745	D545E	probably damaging	Het
Slc7a12	T	C	3: 14,505,381	S398P	probably damaging	Het
Slc9a4	T	C	1: 40,600,771	V241A	probably damaging	Het
Snw1	T	C	12: 87,464,554	D109G	probably damaging	Het
Syne2	T	A	12: 75,933,900	I1477K	probably benign	Het
Timd4	A	T	11: 46,810,864	Y18F	probably benign	Het
Tmprss2	A	G	16: 97,578,597	Y168H	probably benign	Het
Ttn	A	T	2: 76,738,700	I27283K	probably damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Vasn	C	T	16: 4,649,622	R478C	probably benign	Het
Zfp58	A	T	13: 67,491,963	C136*	probably null	Het

Other mutations in F5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00840:F5	APN	1	164179524	missense	probably benign	0.15
IGL00843:F5	APN	1	164211791	missense	probably benign	0.00
IGL00904:F5	APN	1	164194009	missense	probably benign
IGL00913:F5	APN	1	164204896	missense	probably damaging	1.00
IGL01099:F5	APN	1	164194334	missense	probably damaging	0.99
IGL01134:F5	APN	1	164191979	missense	possibly damaging	0.87
IGL01313:F5	APN	1	164193612	missense	probably benign	0.01
IGL01635:F5	APN	1	164207858	missense	probably benign	0.00
IGL01697:F5	APN	1	164194052	missense	probably benign	0.04
IGL01768:F5	APN	1	164176345	missense	probably benign	0.22
IGL01795:F5	APN	1	164194390	missense	probably benign	0.00
IGL01835:F5	APN	1	164194368	missense	probably benign	0.12
IGL01843:F5	APN	1	164211826	missense	probably benign	0.05
IGL01989:F5	APN	1	164176307	missense	probably benign	0.39
IGL02036:F5	APN	1	164183002	splice site	probably benign
IGL02065:F5	APN	1	164190126	missense	probably damaging	1.00
IGL02077:F5	APN	1	164198866	missense	probably damaging	1.00
IGL02139:F5	APN	1	164192674	missense	possibly damaging	0.89
IGL02210:F5	APN	1	164190141	missense	probably benign	0.00
IGL02415:F5	APN	1	164191929	missense	probably damaging	1.00
IGL02440:F5	APN	1	164207066	missense	possibly damaging	0.79
IGL02471:F5	APN	1	164174291	missense	probably damaging	1.00
IGL02535:F5	APN	1	164198733	missense	probably damaging	0.98
IGL02537:F5	APN	1	164193117	missense	probably benign	0.26
IGL02628:F5	APN	1	164194075	missense	probably damaging	0.99
IGL02638:F5	APN	1	164184608	critical splice donor site	probably null
IGL02824:F5	APN	1	164194347	missense	probably benign	0.00
IGL02977:F5	APN	1	164194021	missense	probably damaging	1.00
IGL03028:F5	APN	1	164193000	nonsense	probably null
IGL03064:F5	APN	1	164195594	missense	probably benign	0.04
IGL03127:F5	APN	1	164193538	missense	probably benign	0.45
IGL03131:F5	APN	1	164161819	missense	possibly damaging	0.62
IGL03348:F5	APN	1	164194152	missense	possibly damaging	0.49
IGL03387:F5	APN	1	164193232	missense	probably damaging	1.00
James_dean	UTSW	1	164204820	missense	probably benign	0.43
BB002:F5	UTSW	1	164176366	critical splice donor site	probably null
BB012:F5	UTSW	1	164176366	critical splice donor site	probably null
R0002:F5	UTSW	1	164201631	missense	probably damaging	1.00
R0095:F5	UTSW	1	164191968	nonsense	probably null
R0116:F5	UTSW	1	164184914	missense	probably benign	0.01
R0359:F5	UTSW	1	164179449	missense	probably damaging	1.00
R0426:F5	UTSW	1	164182840	missense	probably damaging	0.99
R0452:F5	UTSW	1	164185107	missense	probably damaging	0.99
R0457:F5	UTSW	1	164194200	missense	probably benign	0.00
R0520:F5	UTSW	1	164209587	missense	probably benign	0.15
R0522:F5	UTSW	1	164211763	missense	probably damaging	1.00
R0554:F5	UTSW	1	164179449	missense	probably damaging	1.00
R0575:F5	UTSW	1	164176244	missense	probably damaging	1.00
R0734:F5	UTSW	1	164198917	missense	probably damaging	1.00
R0739:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1062:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1063:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1149:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1149:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1150:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1151:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1152:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1221:F5	UTSW	1	164161799	missense	probably damaging	1.00
R1284:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1286:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1358:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1360:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1362:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1383:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1465:F5	UTSW	1	164198833	missense	probably benign	0.02
R1465:F5	UTSW	1	164198833	missense	probably benign	0.02
R1545:F5	UTSW	1	164208960	nonsense	probably null
R1561:F5	UTSW	1	164186903	nonsense	probably null
R1623:F5	UTSW	1	164195622	missense	probably damaging	1.00
R1662:F5	UTSW	1	164207888	missense	probably damaging	1.00
R1673:F5	UTSW	1	164179520	missense	probably damaging	1.00
R1689:F5	UTSW	1	164198917	missense	probably damaging	1.00
R1705:F5	UTSW	1	164217490	missense	possibly damaging	0.92
R1732:F5	UTSW	1	164174150	missense	probably damaging	1.00
R1763:F5	UTSW	1	164192535	missense	probably benign	0.04
R1774:F5	UTSW	1	164192535	missense	probably benign	0.04
R1799:F5	UTSW	1	164193531	missense	possibly damaging	0.58
R1800:F5	UTSW	1	164182834	missense	probably damaging	1.00
R1842:F5	UTSW	1	164184560	missense	probably damaging	0.99
R1915:F5	UTSW	1	164182917	missense	probably damaging	0.97
R1926:F5	UTSW	1	164179508	missense	probably damaging	1.00
R2025:F5	UTSW	1	164209475	missense	probably benign	0.05
R2198:F5	UTSW	1	164207034	missense	probably damaging	1.00
R2258:F5	UTSW	1	164192181	missense	probably damaging	1.00
R2264:F5	UTSW	1	164194402	missense	probably benign	0.32
R2281:F5	UTSW	1	164195720	missense	possibly damaging	0.80
R2407:F5	UTSW	1	164211872	missense	probably damaging	1.00
R2445:F5	UTSW	1	164190226	missense	probably damaging	1.00
R2860:F5	UTSW	1	164184964	missense	probably damaging	1.00
R2861:F5	UTSW	1	164184964	missense	probably damaging	1.00
R2862:F5	UTSW	1	164184964	missense	probably damaging	1.00
R2899:F5	UTSW	1	164186900	missense	possibly damaging	0.88
R2910:F5	UTSW	1	164204820	missense	probably benign	0.43
R2912:F5	UTSW	1	164193919	missense	probably damaging	0.98
R2996:F5	UTSW	1	164182917	missense	probably damaging	0.97
R3745:F5	UTSW	1	164186779	missense	possibly damaging	0.79
R3901:F5	UTSW	1	164176229	missense	probably benign	0.08
R3902:F5	UTSW	1	164176229	missense	probably benign	0.08
R4365:F5	UTSW	1	164184950	missense	probably damaging	0.98
R4448:F5	UTSW	1	164198899	missense	possibly damaging	0.52
R4490:F5	UTSW	1	164217395	missense	probably benign	0.40
R4514:F5	UTSW	1	164151997	unclassified	probably benign
R4598:F5	UTSW	1	164204797	missense	probably benign	0.05
R4608:F5	UTSW	1	164209029	missense	probably benign	0.12
R4661:F5	UTSW	1	164184920	missense	probably damaging	1.00
R4667:F5	UTSW	1	164174186	missense	probably benign	0.00
R4689:F5	UTSW	1	164151973	unclassified	probably benign
R4716:F5	UTSW	1	164193919	missense	probably damaging	0.98
R4732:F5	UTSW	1	164181657	missense	probably damaging	1.00
R4733:F5	UTSW	1	164181657	missense	probably damaging	1.00
R4854:F5	UTSW	1	164192146	missense	probably damaging	1.00
R4908:F5	UTSW	1	164211820	missense	probably damaging	1.00
R4971:F5	UTSW	1	164194186	missense	probably benign
R5001:F5	UTSW	1	164195570	missense	probably benign	0.00
R5042:F5	UTSW	1	164219451	missense	probably damaging	1.00
R5056:F5	UTSW	1	164192032	missense	possibly damaging	0.60
R5061:F5	UTSW	1	164194180	missense	probably benign	0.00
R5143:F5	UTSW	1	164211828	missense	probably damaging	0.98
R5622:F5	UTSW	1	164192565	missense	probably benign	0.09
R5626:F5	UTSW	1	164209035	missense	probably damaging	0.98
R5658:F5	UTSW	1	164192338	missense	probably damaging	0.96
R5702:F5	UTSW	1	164194547	nonsense	probably null
R5795:F5	UTSW	1	164152009	missense	probably benign	0.09
R5884:F5	UTSW	1	164195646	missense	probably benign	0.01
R6036:F5	UTSW	1	164184996	missense	probably damaging	0.99
R6036:F5	UTSW	1	164184996	missense	probably damaging	0.99
R6151:F5	UTSW	1	164181635	missense	probably damaging	1.00
R6151:F5	UTSW	1	164190187	missense	probably damaging	1.00
R6345:F5	UTSW	1	164191951	missense	probably benign	0.13
R6391:F5	UTSW	1	164193493	missense	probably damaging	0.99
R6542:F5	UTSW	1	164194468	missense	probably benign	0.32
R6620:F5	UTSW	1	164186806	missense	probably damaging	1.00
R6750:F5	UTSW	1	164193507	missense	possibly damaging	0.58
R6754:F5	UTSW	1	164193763	missense	probably damaging	1.00
R6774:F5	UTSW	1	164186878	missense	probably damaging	1.00
R6802:F5	UTSW	1	164179356	missense	probably damaging	0.98
R6810:F5	UTSW	1	164186902	missense	probably damaging	1.00
R6983:F5	UTSW	1	164194129	missense	probably damaging	1.00
R7000:F5	UTSW	1	164179506	missense	probably damaging	1.00
R7151:F5	UTSW	1	164201661	missense	probably damaging	1.00
R7193:F5	UTSW	1	164219397	missense	probably damaging	1.00
R7324:F5	UTSW	1	164193581	small deletion	probably benign
R7350:F5	UTSW	1	164192708	missense	probably benign	0.08
R7466:F5	UTSW	1	164193328	missense	possibly damaging	0.61
R7503:F5	UTSW	1	164192210	missense	probably damaging	1.00
R7626:F5	UTSW	1	164186912	missense	possibly damaging	0.95
R7742:F5	UTSW	1	164207884	missense	possibly damaging	0.51
R7837:F5	UTSW	1	164186794	missense	probably damaging	1.00
R7848:F5	UTSW	1	164161877	missense	possibly damaging	0.94
R7925:F5	UTSW	1	164176366	critical splice donor site	probably null
R8053:F5	UTSW	1	164192769	missense	probably benign	0.26
R8094:F5	UTSW	1	164208940	missense	probably benign	0.06
R8175:F5	UTSW	1	164192265	nonsense	probably null
R8209:F5	UTSW	1	164194390	missense	probably benign	0.00
R8226:F5	UTSW	1	164194390	missense	probably benign	0.00
R8266:F5	UTSW	1	164185124	critical splice donor site	probably null
R8517:F5	UTSW	1	164176253	missense	probably damaging	0.99
R8684:F5	UTSW	1	164217542	missense	probably benign	0.01
R8941:F5	UTSW	1	164198871	missense	probably benign	0.19
R9130:F5	UTSW	1	164174261	missense	probably benign	0.37
R9181:F5	UTSW	1	164192326	missense	probably benign	0.00
R9186:F5	UTSW	1	164193901	missense	probably benign
R9233:F5	UTSW	1	164219451	missense	probably damaging	1.00
R9314:F5	UTSW	1	164201577	missense	probably benign	0.01
R9631:F5	UTSW	1	164186854	missense	probably damaging	1.00
R9655:F5	UTSW	1	164194161	missense	probably benign	0.15
X0024:F5	UTSW	1	164192988	missense	probably damaging	1.00
Z1088:F5	UTSW	1	164154385	missense	probably benign	0.04
Z1176:F5	UTSW	1	164184516	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GAGTGTCATTGGCGCCATCTAG -3'
(R):5'- TAAAATACCTGTACACCCCTCTGG -3'

Sequencing Primer
(F):5'- GCTACATGCTATCCATAGTCAGGAG -3'
(R):5'- GTCCAGGGACCTGCTCTTAC -3'

Posted On

2019-06-26