Incidental Mutation 'R7230:Etl4'
ID 562399
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Name enhancer trap locus 4
Synonyms 6620402G01Rik, Sickle tail, E330027G05Rik, Etl-4, Skt, 9430077C05Rik
MMRRC Submission 045302-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.809) question?
Stock # R7230 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 19915018-20815346 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20802799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1035 (T1035K)
Ref Sequence ENSEMBL: ENSMUSP00000041431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114614] [ENSMUST00000114627]
AlphaFold A2AQ25
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: T1035K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: T1035K

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: T1070K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: T1070K

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: T1070K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: T1070K

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114606
AA Change: T753K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617
AA Change: T753K

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114607
AA Change: T753K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617
AA Change: T753K

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114608
AA Change: T753K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: T753K

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
coiled coil region 338 370 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 1055 1064 N/A INTRINSIC
low complexity region 1153 1178 N/A INTRINSIC
low complexity region 1254 1265 N/A INTRINSIC
coiled coil region 1341 1369 N/A INTRINSIC
low complexity region 1407 1420 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: T1024K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: T1024K

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: T1121K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: T1121K

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Meta Mutation Damage Score 0.1537 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 45,766,812 (GRCm39) D989E probably benign Het
Adad1 A G 3: 37,119,315 (GRCm39) Y132C probably damaging Het
Adam33 A T 2: 130,895,483 (GRCm39) C579S probably damaging Het
Adam6a A C 12: 113,509,202 (GRCm39) Q525P probably damaging Het
Alpk3 C T 7: 80,743,042 (GRCm39) P953L probably damaging Het
Arb2a G A 13: 77,907,591 (GRCm39) E5K probably damaging Het
Atat1 A G 17: 36,220,331 (GRCm39) S54P probably damaging Het
Bpgm A G 6: 34,464,502 (GRCm39) E73G possibly damaging Het
Cab39 T A 1: 85,775,880 (GRCm39) probably null Het
Ccdc162 A G 10: 41,554,809 (GRCm39) L285P probably damaging Het
Ccdc30 T C 4: 119,196,979 (GRCm39) E429G possibly damaging Het
Cct3 C T 3: 88,220,567 (GRCm39) R260W probably damaging Het
Chd1 C A 17: 15,927,199 (GRCm39) probably null Het
Cxcr4 T G 1: 128,517,527 (GRCm39) T45P probably damaging Het
Disp2 G T 2: 118,622,286 (GRCm39) R1006L probably damaging Het
Dlec1 T G 9: 118,953,606 (GRCm39) probably null Het
Dram2 T G 3: 106,480,294 (GRCm39) Y202* probably null Het
F5 T C 1: 164,012,522 (GRCm39) F479L probably benign Het
Frrs1l C A 4: 56,972,372 (GRCm39) G110W probably damaging Het
Gpbp1l1 T A 4: 116,445,807 (GRCm39) I303N probably damaging Het
Grik5 A G 7: 24,722,495 (GRCm39) F538S probably damaging Het
Hgsnat C A 8: 26,444,860 (GRCm39) probably null Het
Hs2st1 T C 3: 144,140,307 (GRCm39) D338G probably benign Het
Impdh1 T C 6: 29,206,062 (GRCm39) probably null Het
Ipo9 T C 1: 135,334,496 (GRCm39) probably benign Het
Kdm4b T G 17: 56,676,155 (GRCm39) L220R probably damaging Het
Map1a T A 2: 121,131,299 (GRCm39) F705Y probably damaging Het
Med22 C T 2: 26,798,223 (GRCm39) D99N probably benign Het
Muc6 T C 7: 141,235,479 (GRCm39) Y519C probably damaging Het
Myt1l A G 12: 29,833,873 (GRCm39) I25M probably damaging Het
Ncam1 T A 9: 49,421,123 (GRCm39) I731F probably benign Het
Nlrp4f T A 13: 65,342,715 (GRCm39) H310L probably benign Het
Or2ag1b A T 7: 106,288,731 (GRCm39) M69K possibly damaging Het
Or2ag2b C A 7: 106,417,386 (GRCm39) T32K possibly damaging Het
Or4f14 T A 2: 111,742,906 (GRCm39) Y123F probably damaging Het
Or4k40 A T 2: 111,251,261 (GRCm39) F12I probably damaging Het
Prl8a6 T A 13: 27,617,021 (GRCm39) Y223F probably benign Het
Prss39 A G 1: 34,541,228 (GRCm39) D244G probably damaging Het
Ptx4 A T 17: 25,342,077 (GRCm39) Q184L possibly damaging Het
Slc26a1 A T 5: 108,819,611 (GRCm39) D545E probably damaging Het
Slc7a12 T C 3: 14,570,441 (GRCm39) S398P probably damaging Het
Slc9a4 T C 1: 40,639,931 (GRCm39) V241A probably damaging Het
Snw1 T C 12: 87,511,324 (GRCm39) D109G probably damaging Het
Syne2 T A 12: 75,980,674 (GRCm39) I1477K probably benign Het
Timd4 A T 11: 46,701,691 (GRCm39) Y18F probably benign Het
Tmprss2 A G 16: 97,379,797 (GRCm39) Y168H probably benign Het
Ttn A T 2: 76,569,044 (GRCm39) I27283K probably damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Vasn C T 16: 4,467,486 (GRCm39) R478C probably benign Het
Zfp58 A T 13: 67,640,082 (GRCm39) C136* probably null Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20,771,289 (GRCm39) missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20,534,865 (GRCm39) missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20,811,342 (GRCm39) nonsense probably null
IGL01099:Etl4 APN 2 20,811,922 (GRCm39) missense probably benign 0.06
IGL01337:Etl4 APN 2 20,790,198 (GRCm39) missense probably benign 0.01
IGL01348:Etl4 APN 2 20,811,784 (GRCm39) missense probably damaging 1.00
IGL01349:Etl4 APN 2 20,718,207 (GRCm39) missense probably damaging 1.00
IGL01407:Etl4 APN 2 20,748,667 (GRCm39) missense probably damaging 0.99
IGL01552:Etl4 APN 2 20,783,000 (GRCm39) missense probably damaging 0.99
IGL01662:Etl4 APN 2 20,811,460 (GRCm39) missense probably benign 0.04
IGL01687:Etl4 APN 2 20,534,898 (GRCm39) missense probably damaging 1.00
IGL01793:Etl4 APN 2 20,748,709 (GRCm39) missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20,811,493 (GRCm39) missense probably benign 0.06
IGL02025:Etl4 APN 2 20,811,337 (GRCm39) missense probably damaging 1.00
IGL02088:Etl4 APN 2 20,811,359 (GRCm39) missense probably damaging 1.00
IGL02134:Etl4 APN 2 20,811,240 (GRCm39) missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20,535,000 (GRCm39) missense probably damaging 1.00
IGL02480:Etl4 APN 2 20,793,335 (GRCm39) missense probably damaging 0.99
IGL02560:Etl4 APN 2 20,748,529 (GRCm39) missense probably damaging 1.00
IGL02851:Etl4 APN 2 20,812,840 (GRCm39) missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20,765,021 (GRCm39) splice site probably benign
IGL02951:Etl4 APN 2 20,806,348 (GRCm39) splice site probably benign
IGL03119:Etl4 APN 2 20,718,198 (GRCm39) missense probably damaging 1.00
IGL03267:Etl4 APN 2 20,789,993 (GRCm39) nonsense probably null
IGL03379:Etl4 APN 2 20,666,827 (GRCm39) missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0095:Etl4 UTSW 2 20,748,679 (GRCm39) missense probably damaging 1.00
R0100:Etl4 UTSW 2 20,344,716 (GRCm39) missense probably benign
R0311:Etl4 UTSW 2 20,811,940 (GRCm39) missense probably damaging 1.00
R0346:Etl4 UTSW 2 20,764,463 (GRCm39) critical splice donor site probably null
R0348:Etl4 UTSW 2 20,782,940 (GRCm39) missense probably damaging 1.00
R0379:Etl4 UTSW 2 20,812,165 (GRCm39) missense probably damaging 0.98
R0571:Etl4 UTSW 2 20,748,580 (GRCm39) missense probably damaging 0.99
R0697:Etl4 UTSW 2 20,748,672 (GRCm39) missense probably damaging 1.00
R0707:Etl4 UTSW 2 20,810,382 (GRCm39) splice site probably benign
R0980:Etl4 UTSW 2 20,806,378 (GRCm39) missense probably damaging 1.00
R1120:Etl4 UTSW 2 20,811,514 (GRCm39) missense probably benign 0.00
R1254:Etl4 UTSW 2 20,812,734 (GRCm39) missense probably damaging 1.00
R1346:Etl4 UTSW 2 20,810,955 (GRCm39) missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20,793,288 (GRCm39) missense probably damaging 1.00
R1503:Etl4 UTSW 2 20,748,685 (GRCm39) missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R1627:Etl4 UTSW 2 20,806,390 (GRCm39) missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20,811,219 (GRCm39) missense probably damaging 1.00
R1716:Etl4 UTSW 2 20,748,492 (GRCm39) missense probably damaging 1.00
R1795:Etl4 UTSW 2 20,812,837 (GRCm39) critical splice donor site probably null
R1885:Etl4 UTSW 2 20,748,795 (GRCm39) missense probably damaging 1.00
R2039:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R2083:Etl4 UTSW 2 20,748,360 (GRCm39) missense probably damaging 1.00
R2109:Etl4 UTSW 2 20,790,153 (GRCm39) missense probably benign 0.27
R2153:Etl4 UTSW 2 20,803,545 (GRCm39) missense probably benign 0.00
R2403:Etl4 UTSW 2 20,812,117 (GRCm39) nonsense probably null
R2883:Etl4 UTSW 2 20,810,985 (GRCm39) missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20,786,660 (GRCm39) missense probably damaging 1.00
R3402:Etl4 UTSW 2 20,786,693 (GRCm39) missense probably damaging 1.00
R3696:Etl4 UTSW 2 20,806,473 (GRCm39) critical splice donor site probably null
R3755:Etl4 UTSW 2 20,748,348 (GRCm39) missense probably benign 0.10
R3813:Etl4 UTSW 2 20,793,246 (GRCm39) missense probably damaging 1.00
R3829:Etl4 UTSW 2 20,790,232 (GRCm39) missense probably benign 0.07
R3887:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3888:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3889:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3958:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3959:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3960:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R4058:Etl4 UTSW 2 20,810,830 (GRCm39) missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20,814,030 (GRCm39) utr 3 prime probably benign
R4077:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4078:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4127:Etl4 UTSW 2 20,748,886 (GRCm39) missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20,786,694 (GRCm39) missense probably damaging 1.00
R4492:Etl4 UTSW 2 20,811,676 (GRCm39) missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20,666,709 (GRCm39) missense probably damaging 1.00
R4820:Etl4 UTSW 2 20,811,496 (GRCm39) missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20,811,738 (GRCm39) missense probably damaging 1.00
R4888:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R4938:Etl4 UTSW 2 20,803,460 (GRCm39) missense probably benign 0.00
R4943:Etl4 UTSW 2 20,812,092 (GRCm39) missense probably benign 0.05
R5121:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R5191:Etl4 UTSW 2 20,344,810 (GRCm39) missense probably damaging 0.99
R5198:Etl4 UTSW 2 20,718,198 (GRCm39) missense probably damaging 1.00
R5199:Etl4 UTSW 2 20,748,853 (GRCm39) missense probably damaging 1.00
R5470:Etl4 UTSW 2 20,534,791 (GRCm39) missense probably damaging 0.99
R5513:Etl4 UTSW 2 20,748,638 (GRCm39) missense probably damaging 1.00
R5620:Etl4 UTSW 2 20,535,037 (GRCm39) missense probably damaging 1.00
R5635:Etl4 UTSW 2 20,811,846 (GRCm39) missense probably damaging 1.00
R5641:Etl4 UTSW 2 20,811,273 (GRCm39) frame shift probably null
R5690:Etl4 UTSW 2 20,810,647 (GRCm39) missense probably benign 0.01
R5784:Etl4 UTSW 2 20,811,016 (GRCm39) missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20,811,323 (GRCm39) missense probably damaging 1.00
R5908:Etl4 UTSW 2 20,748,718 (GRCm39) missense probably damaging 0.96
R5982:Etl4 UTSW 2 20,785,826 (GRCm39) missense probably damaging 1.00
R6151:Etl4 UTSW 2 20,718,171 (GRCm39) missense probably damaging 1.00
R6192:Etl4 UTSW 2 20,806,362 (GRCm39) missense probably damaging 0.98
R6238:Etl4 UTSW 2 20,806,379 (GRCm39) missense probably damaging 1.00
R6248:Etl4 UTSW 2 20,813,900 (GRCm39) missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20,748,384 (GRCm39) missense probably damaging 1.00
R6610:Etl4 UTSW 2 20,718,180 (GRCm39) missense probably damaging 1.00
R6739:Etl4 UTSW 2 20,718,246 (GRCm39) missense probably damaging 1.00
R6846:Etl4 UTSW 2 20,748,919 (GRCm39) missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20,811,120 (GRCm39) missense probably benign 0.01
R6873:Etl4 UTSW 2 20,802,803 (GRCm39) splice site probably null
R7003:Etl4 UTSW 2 20,810,695 (GRCm39) missense probably benign 0.03
R7155:Etl4 UTSW 2 20,811,742 (GRCm39) missense probably damaging 0.96
R7207:Etl4 UTSW 2 20,714,387 (GRCm39) missense probably damaging 0.99
R7305:Etl4 UTSW 2 20,714,368 (GRCm39) missense probably damaging 1.00
R7389:Etl4 UTSW 2 20,789,904 (GRCm39) nonsense probably null
R7396:Etl4 UTSW 2 20,803,449 (GRCm39) missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20,749,000 (GRCm39) missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20,718,189 (GRCm39) missense probably damaging 1.00
R7776:Etl4 UTSW 2 20,811,957 (GRCm39) missense probably damaging 0.99
R7779:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R7798:Etl4 UTSW 2 20,786,757 (GRCm39) critical splice donor site probably null
R7851:Etl4 UTSW 2 20,748,951 (GRCm39) missense probably damaging 1.00
R7861:Etl4 UTSW 2 20,810,721 (GRCm39) missense probably benign
R7901:Etl4 UTSW 2 20,294,821 (GRCm39) missense possibly damaging 0.83
R8053:Etl4 UTSW 2 20,666,774 (GRCm39) missense probably damaging 1.00
R8124:Etl4 UTSW 2 20,811,451 (GRCm39) missense probably benign 0.06
R8133:Etl4 UTSW 2 20,811,082 (GRCm39) missense possibly damaging 0.86
R8203:Etl4 UTSW 2 20,789,916 (GRCm39) missense possibly damaging 0.61
R8238:Etl4 UTSW 2 20,811,342 (GRCm39) nonsense probably null
R8263:Etl4 UTSW 2 20,748,965 (GRCm39) missense probably benign 0.00
R8299:Etl4 UTSW 2 20,748,874 (GRCm39) missense possibly damaging 0.81
R8318:Etl4 UTSW 2 20,793,341 (GRCm39) missense probably damaging 1.00
R8334:Etl4 UTSW 2 20,785,857 (GRCm39) missense probably damaging 0.96
R8443:Etl4 UTSW 2 20,810,977 (GRCm39) missense probably benign 0.04
R8525:Etl4 UTSW 2 20,534,892 (GRCm39) missense probably damaging 1.00
R8679:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R8918:Etl4 UTSW 2 20,811,246 (GRCm39) missense probably benign 0.00
R8918:Etl4 UTSW 2 20,748,733 (GRCm39) missense probably benign
R9062:Etl4 UTSW 2 20,748,616 (GRCm39) missense probably damaging 0.99
R9095:Etl4 UTSW 2 20,782,964 (GRCm39) missense probably damaging 1.00
R9200:Etl4 UTSW 2 20,786,702 (GRCm39) missense probably damaging 1.00
R9416:Etl4 UTSW 2 20,748,784 (GRCm39) missense probably benign 0.17
R9437:Etl4 UTSW 2 20,813,872 (GRCm39) missense probably benign 0.20
R9451:Etl4 UTSW 2 20,813,926 (GRCm39) missense probably benign 0.03
R9489:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9531:Etl4 UTSW 2 20,294,818 (GRCm39) start codon destroyed probably null 0.01
R9605:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9623:Etl4 UTSW 2 20,811,052 (GRCm39) missense
R9631:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9632:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9646:Etl4 UTSW 2 20,802,724 (GRCm39) missense probably benign 0.00
R9732:Etl4 UTSW 2 20,748,373 (GRCm39) missense probably damaging 0.98
R9755:Etl4 UTSW 2 20,790,048 (GRCm39) missense probably benign 0.17
R9771:Etl4 UTSW 2 20,811,537 (GRCm39) missense probably benign
RF003:Etl4 UTSW 2 20,524,729 (GRCm39) nonsense probably null
X0018:Etl4 UTSW 2 20,814,001 (GRCm39) missense probably damaging 0.98
X0022:Etl4 UTSW 2 20,714,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTATGGTGAGACTAGAGTTTG -3'
(R):5'- AGGCTAGTCCAACAGCACTG -3'

Sequencing Primer
(F):5'- ATGGTGAGACTAGAGTTTGTAAGTG -3'
(R):5'- GCACTGGCTGACATTCCC -3'
Posted On 2019-06-26