Incidental Mutation 'R0576:Olfr748'
ID 56240
Institutional Source Beutler Lab
Gene Symbol Olfr748
Ensembl Gene ENSMUSG00000060084
Gene Name olfactory receptor 748
Synonyms GA_x6K02T2PMLR-6454789-6455712, MOR106-9P
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R0576 (G1)
Quality Score 210
Status Validated
Chromosome 14
Chromosomal Location 50707373-50713797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50711204 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 291 (S291R)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
AlphaFold E9Q9Z0
Predicted Effect probably damaging
Transcript: ENSMUST00000073561
AA Change: S291R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: S291R

Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213101
AA Change: S291R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Olfr748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Olfr748 APN 14 50710993 missense possibly damaging 0.95
IGL02965:Olfr748 APN 14 50711196 missense probably damaging 1.00
R1184:Olfr748 UTSW 14 50710614 missense probably benign 0.01
R2129:Olfr748 UTSW 14 50710636 missense probably damaging 0.99
R2895:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R2896:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R4017:Olfr748 UTSW 14 50710876 missense probably benign 0.03
R5053:Olfr748 UTSW 14 50710511 nonsense probably null
R5057:Olfr748 UTSW 14 50711212 missense probably damaging 1.00
R5113:Olfr748 UTSW 14 50710914 missense probably benign 0.00
R5294:Olfr748 UTSW 14 50710443 missense possibly damaging 0.95
R5294:Olfr748 UTSW 14 50710779 missense probably benign 0.01
R5499:Olfr748 UTSW 14 50710867 missense probably damaging 1.00
R5582:Olfr748 UTSW 14 50710968 missense probably damaging 1.00
R5727:Olfr748 UTSW 14 50710360 missense possibly damaging 0.74
R6797:Olfr748 UTSW 14 50711106 missense probably damaging 1.00
R7685:Olfr748 UTSW 14 50710758 missense possibly damaging 0.95
R7717:Olfr748 UTSW 14 50710762 missense probably damaging 1.00
R7778:Olfr748 UTSW 14 50710471 missense possibly damaging 0.60
R8276:Olfr748 UTSW 14 50710830 missense probably benign 0.28
R8839:Olfr748 UTSW 14 50710500 missense possibly damaging 0.73
R9322:Olfr748 UTSW 14 50711050 missense probably damaging 1.00
R9358:Olfr748 UTSW 14 50710345 missense probably benign
Predicted Primers PCR Primer
(R):5'- tggtgagctatctttCCATCCTTGACT -3'

Sequencing Primer
(R):5'- caaccactgagattaaaggcac -3'
Posted On 2013-07-11