Incidental Mutation 'R7230:Or4f14'
ID 562403
Institutional Source Beutler Lab
Gene Symbol Or4f14
Ensembl Gene ENSMUSG00000096566
Gene Name olfactory receptor family 4 subfamily F member 14
Synonyms Olfr1306, GA_x6K02T2Q125-72954873-72953935, MOR245-15
MMRRC Submission 045302-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R7230 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111742335-111743273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111742906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 123 (Y123F)
Ref Sequence ENSEMBL: ENSMUSP00000151142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099607] [ENSMUST00000214844]
AlphaFold A2BFL7
Predicted Effect probably damaging
Transcript: ENSMUST00000099607
AA Change: Y123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097202
Gene: ENSMUSG00000096566
AA Change: Y123F

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 4.7e-43 PFAM
Pfam:7tm_1 41 287 9.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214844
AA Change: Y123F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 45,766,812 (GRCm39) D989E probably benign Het
Adad1 A G 3: 37,119,315 (GRCm39) Y132C probably damaging Het
Adam33 A T 2: 130,895,483 (GRCm39) C579S probably damaging Het
Adam6a A C 12: 113,509,202 (GRCm39) Q525P probably damaging Het
Alpk3 C T 7: 80,743,042 (GRCm39) P953L probably damaging Het
Arb2a G A 13: 77,907,591 (GRCm39) E5K probably damaging Het
Atat1 A G 17: 36,220,331 (GRCm39) S54P probably damaging Het
Bpgm A G 6: 34,464,502 (GRCm39) E73G possibly damaging Het
Cab39 T A 1: 85,775,880 (GRCm39) probably null Het
Ccdc162 A G 10: 41,554,809 (GRCm39) L285P probably damaging Het
Ccdc30 T C 4: 119,196,979 (GRCm39) E429G possibly damaging Het
Cct3 C T 3: 88,220,567 (GRCm39) R260W probably damaging Het
Chd1 C A 17: 15,927,199 (GRCm39) probably null Het
Cxcr4 T G 1: 128,517,527 (GRCm39) T45P probably damaging Het
Disp2 G T 2: 118,622,286 (GRCm39) R1006L probably damaging Het
Dlec1 T G 9: 118,953,606 (GRCm39) probably null Het
Dram2 T G 3: 106,480,294 (GRCm39) Y202* probably null Het
Etl4 C A 2: 20,802,799 (GRCm39) T1035K probably damaging Het
F5 T C 1: 164,012,522 (GRCm39) F479L probably benign Het
Frrs1l C A 4: 56,972,372 (GRCm39) G110W probably damaging Het
Gpbp1l1 T A 4: 116,445,807 (GRCm39) I303N probably damaging Het
Grik5 A G 7: 24,722,495 (GRCm39) F538S probably damaging Het
Hgsnat C A 8: 26,444,860 (GRCm39) probably null Het
Hs2st1 T C 3: 144,140,307 (GRCm39) D338G probably benign Het
Impdh1 T C 6: 29,206,062 (GRCm39) probably null Het
Ipo9 T C 1: 135,334,496 (GRCm39) probably benign Het
Kdm4b T G 17: 56,676,155 (GRCm39) L220R probably damaging Het
Map1a T A 2: 121,131,299 (GRCm39) F705Y probably damaging Het
Med22 C T 2: 26,798,223 (GRCm39) D99N probably benign Het
Muc6 T C 7: 141,235,479 (GRCm39) Y519C probably damaging Het
Myt1l A G 12: 29,833,873 (GRCm39) I25M probably damaging Het
Ncam1 T A 9: 49,421,123 (GRCm39) I731F probably benign Het
Nlrp4f T A 13: 65,342,715 (GRCm39) H310L probably benign Het
Or2ag1b A T 7: 106,288,731 (GRCm39) M69K possibly damaging Het
Or2ag2b C A 7: 106,417,386 (GRCm39) T32K possibly damaging Het
Or4k40 A T 2: 111,251,261 (GRCm39) F12I probably damaging Het
Prl8a6 T A 13: 27,617,021 (GRCm39) Y223F probably benign Het
Prss39 A G 1: 34,541,228 (GRCm39) D244G probably damaging Het
Ptx4 A T 17: 25,342,077 (GRCm39) Q184L possibly damaging Het
Slc26a1 A T 5: 108,819,611 (GRCm39) D545E probably damaging Het
Slc7a12 T C 3: 14,570,441 (GRCm39) S398P probably damaging Het
Slc9a4 T C 1: 40,639,931 (GRCm39) V241A probably damaging Het
Snw1 T C 12: 87,511,324 (GRCm39) D109G probably damaging Het
Syne2 T A 12: 75,980,674 (GRCm39) I1477K probably benign Het
Timd4 A T 11: 46,701,691 (GRCm39) Y18F probably benign Het
Tmprss2 A G 16: 97,379,797 (GRCm39) Y168H probably benign Het
Ttn A T 2: 76,569,044 (GRCm39) I27283K probably damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Vasn C T 16: 4,467,486 (GRCm39) R478C probably benign Het
Zfp58 A T 13: 67,640,082 (GRCm39) C136* probably null Het
Other mutations in Or4f14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Or4f14 APN 2 111,742,381 (GRCm39) missense possibly damaging 0.95
IGL01310:Or4f14 APN 2 111,742,652 (GRCm39) missense probably benign 0.34
IGL01893:Or4f14 APN 2 111,742,589 (GRCm39) missense possibly damaging 0.65
IGL02433:Or4f14 APN 2 111,742,762 (GRCm39) missense probably damaging 1.00
IGL03302:Or4f14 APN 2 111,743,167 (GRCm39) missense possibly damaging 0.61
R0544:Or4f14 UTSW 2 111,742,905 (GRCm39) nonsense probably null
R0674:Or4f14 UTSW 2 111,743,018 (GRCm39) missense probably benign 0.41
R1118:Or4f14 UTSW 2 111,743,222 (GRCm39) missense probably benign 0.02
R1764:Or4f14 UTSW 2 111,742,526 (GRCm39) missense possibly damaging 0.93
R2915:Or4f14 UTSW 2 111,743,064 (GRCm39) missense probably damaging 1.00
R3976:Or4f14 UTSW 2 111,742,951 (GRCm39) missense possibly damaging 0.84
R4855:Or4f14 UTSW 2 111,742,444 (GRCm39) missense probably benign 0.41
R6475:Or4f14 UTSW 2 111,743,204 (GRCm39) nonsense probably null
R6513:Or4f14 UTSW 2 111,743,228 (GRCm39) missense possibly damaging 0.89
R6536:Or4f14 UTSW 2 111,743,119 (GRCm39) missense possibly damaging 0.94
R6748:Or4f14 UTSW 2 111,742,702 (GRCm39) missense possibly damaging 0.47
R6843:Or4f14 UTSW 2 111,743,260 (GRCm39) missense probably damaging 1.00
R7006:Or4f14 UTSW 2 111,742,601 (GRCm39) missense probably benign 0.16
R7169:Or4f14 UTSW 2 111,742,939 (GRCm39) missense possibly damaging 0.95
R7419:Or4f14 UTSW 2 111,742,435 (GRCm39) missense probably damaging 1.00
R7448:Or4f14 UTSW 2 111,742,637 (GRCm39) missense probably benign 0.00
R7753:Or4f14 UTSW 2 111,742,927 (GRCm39) missense probably benign 0.06
R7761:Or4f14 UTSW 2 111,743,222 (GRCm39) missense probably benign 0.02
R8330:Or4f14 UTSW 2 111,742,724 (GRCm39) missense probably benign 0.00
R8497:Or4f14 UTSW 2 111,742,964 (GRCm39) missense possibly damaging 0.82
R8942:Or4f14 UTSW 2 111,743,207 (GRCm39) missense probably benign 0.05
R9603:Or4f14 UTSW 2 111,743,128 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCACAGTAGAAGCTGTCCAAC -3'
(R):5'- GTTCACTGTGGCATCTGACC -3'

Sequencing Primer
(F):5'- CAGTAGAAGCTGTCCAACACATTTG -3'
(R):5'- GTGGCATCTGACCCTCAC -3'
Posted On 2019-06-26