Incidental Mutation 'R0576:Tbc1d31'
ID56241
Institutional Source Beutler Lab
Gene Symbol Tbc1d31
Ensembl Gene ENSMUSG00000022364
Gene NameTBC1 domain family, member 31
SynonymsLOC210544, Wdr67, D330013L20Rik
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0576 (G1)
Quality Score196
Status Validated
Chromosome15
Chromosomal Location57912199-57970067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57969724 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 953 (I953N)
Ref Sequence ENSEMBL: ENSMUSP00000022992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022992
AA Change: I953N

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022992
Gene: ENSMUSG00000022364
AA Change: I953N

DomainStartEndE-ValueType
WD40 39 70 3.3e1 SMART
WD40 72 112 7.64e1 SMART
WD40 115 153 1.42e-4 SMART
WD40 156 196 1.03e1 SMART
WD40 199 242 6.6e1 SMART
Blast:WD40 245 292 8e-23 BLAST
WD40 295 334 2.48e0 SMART
Pfam:RabGAP-TBC 427 619 9.5e-11 PFAM
coiled coil region 699 844 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161329
AA Change: I190N
SMART Domains Protein: ENSMUSP00000124466
Gene: ENSMUSG00000022364
AA Change: I190N

DomainStartEndE-ValueType
coiled coil region 97 124 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Tbc1d31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Tbc1d31 APN 15 57940768 missense probably benign 0.03
IGL01955:Tbc1d31 APN 15 57942370 missense probably benign 0.24
IGL02024:Tbc1d31 APN 15 57919942 missense probably benign 0.10
IGL02501:Tbc1d31 APN 15 57937948 missense probably benign 0.11
IGL03133:Tbc1d31 APN 15 57942459 splice site probably benign
IGL03159:Tbc1d31 APN 15 57920048 critical splice donor site probably null
new_age UTSW 15 57951706 missense probably damaging 1.00
PIT4354001:Tbc1d31 UTSW 15 57967933 missense probably benign 0.09
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0375:Tbc1d31 UTSW 15 57955350 missense probably benign
R0478:Tbc1d31 UTSW 15 57932536 missense probably damaging 1.00
R1328:Tbc1d31 UTSW 15 57942463 splice site probably benign
R1454:Tbc1d31 UTSW 15 57951638 nonsense probably null
R1784:Tbc1d31 UTSW 15 57963920 missense possibly damaging 0.86
R1874:Tbc1d31 UTSW 15 57916110 missense probably benign 0.41
R1920:Tbc1d31 UTSW 15 57912364 missense probably damaging 1.00
R2111:Tbc1d31 UTSW 15 57932644 missense probably benign 0.05
R2174:Tbc1d31 UTSW 15 57951741 missense possibly damaging 0.95
R2205:Tbc1d31 UTSW 15 57953520 missense probably benign 0.11
R3683:Tbc1d31 UTSW 15 57951814 critical splice donor site probably null
R3825:Tbc1d31 UTSW 15 57916078 missense probably benign 0.43
R4407:Tbc1d31 UTSW 15 57920042 missense possibly damaging 0.93
R4627:Tbc1d31 UTSW 15 57967912 missense probably benign
R4792:Tbc1d31 UTSW 15 57940728 missense probably benign 0.03
R4804:Tbc1d31 UTSW 15 57951106 nonsense probably null
R4909:Tbc1d31 UTSW 15 57962265 critical splice donor site probably null
R5077:Tbc1d31 UTSW 15 57955401 missense probably benign 0.00
R5230:Tbc1d31 UTSW 15 57960919 missense probably damaging 0.99
R5436:Tbc1d31 UTSW 15 57952871 missense probably benign 0.04
R5652:Tbc1d31 UTSW 15 57951666 missense probably damaging 1.00
R5920:Tbc1d31 UTSW 15 57942558 missense probably benign 0.10
R6102:Tbc1d31 UTSW 15 57936093 missense probably damaging 1.00
R6176:Tbc1d31 UTSW 15 57952796 missense probably damaging 0.99
R6513:Tbc1d31 UTSW 15 57955382 missense probably damaging 1.00
R6778:Tbc1d31 UTSW 15 57938029 missense probably damaging 1.00
R6795:Tbc1d31 UTSW 15 57951706 missense probably damaging 1.00
R7187:Tbc1d31 UTSW 15 57938063 missense possibly damaging 0.95
R7308:Tbc1d31 UTSW 15 57952816 missense probably damaging 1.00
R7359:Tbc1d31 UTSW 15 57916108 missense probably benign 0.00
R7453:Tbc1d31 UTSW 15 57950995 missense probably damaging 1.00
R7552:Tbc1d31 UTSW 15 57940740 missense probably benign
R7606:Tbc1d31 UTSW 15 57951670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTCCAGCAGCCTGCTACTTTAG -3'
(R):5'- AGATTCCAGAAGCCCTTTACAAGCC -3'

Sequencing Primer
(F):5'- ACGCTACAATGGTCCTGTATTTG -3'
(R):5'- GAAGCCCTTTACAAGCCAAAGC -3'
Posted On2013-07-11