Incidental Mutation 'R7230:Gpbp1l1'
ID 562413
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene Name GC-rich promoter binding protein 1-like 1
Synonyms 5330440M15Rik
MMRRC Submission 045302-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7230 (G1)
Quality Score 224.009
Status Validated
Chromosome 4
Chromosomal Location 116414855-116451079 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116445807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 303 (I303N)
Ref Sequence ENSEMBL: ENSMUSP00000030460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
AlphaFold Q6NZP2
Predicted Effect probably damaging
Transcript: ENSMUST00000030460
AA Change: I303N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: I303N

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106475
AA Change: I303N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: I303N

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Meta Mutation Damage Score 0.3599 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 45,766,812 (GRCm39) D989E probably benign Het
Adad1 A G 3: 37,119,315 (GRCm39) Y132C probably damaging Het
Adam33 A T 2: 130,895,483 (GRCm39) C579S probably damaging Het
Adam6a A C 12: 113,509,202 (GRCm39) Q525P probably damaging Het
Alpk3 C T 7: 80,743,042 (GRCm39) P953L probably damaging Het
Arb2a G A 13: 77,907,591 (GRCm39) E5K probably damaging Het
Atat1 A G 17: 36,220,331 (GRCm39) S54P probably damaging Het
Bpgm A G 6: 34,464,502 (GRCm39) E73G possibly damaging Het
Cab39 T A 1: 85,775,880 (GRCm39) probably null Het
Ccdc162 A G 10: 41,554,809 (GRCm39) L285P probably damaging Het
Ccdc30 T C 4: 119,196,979 (GRCm39) E429G possibly damaging Het
Cct3 C T 3: 88,220,567 (GRCm39) R260W probably damaging Het
Chd1 C A 17: 15,927,199 (GRCm39) probably null Het
Cxcr4 T G 1: 128,517,527 (GRCm39) T45P probably damaging Het
Disp2 G T 2: 118,622,286 (GRCm39) R1006L probably damaging Het
Dlec1 T G 9: 118,953,606 (GRCm39) probably null Het
Dram2 T G 3: 106,480,294 (GRCm39) Y202* probably null Het
Etl4 C A 2: 20,802,799 (GRCm39) T1035K probably damaging Het
F5 T C 1: 164,012,522 (GRCm39) F479L probably benign Het
Frrs1l C A 4: 56,972,372 (GRCm39) G110W probably damaging Het
Grik5 A G 7: 24,722,495 (GRCm39) F538S probably damaging Het
Hgsnat C A 8: 26,444,860 (GRCm39) probably null Het
Hs2st1 T C 3: 144,140,307 (GRCm39) D338G probably benign Het
Impdh1 T C 6: 29,206,062 (GRCm39) probably null Het
Ipo9 T C 1: 135,334,496 (GRCm39) probably benign Het
Kdm4b T G 17: 56,676,155 (GRCm39) L220R probably damaging Het
Map1a T A 2: 121,131,299 (GRCm39) F705Y probably damaging Het
Med22 C T 2: 26,798,223 (GRCm39) D99N probably benign Het
Muc6 T C 7: 141,235,479 (GRCm39) Y519C probably damaging Het
Myt1l A G 12: 29,833,873 (GRCm39) I25M probably damaging Het
Ncam1 T A 9: 49,421,123 (GRCm39) I731F probably benign Het
Nlrp4f T A 13: 65,342,715 (GRCm39) H310L probably benign Het
Or2ag1b A T 7: 106,288,731 (GRCm39) M69K possibly damaging Het
Or2ag2b C A 7: 106,417,386 (GRCm39) T32K possibly damaging Het
Or4f14 T A 2: 111,742,906 (GRCm39) Y123F probably damaging Het
Or4k40 A T 2: 111,251,261 (GRCm39) F12I probably damaging Het
Prl8a6 T A 13: 27,617,021 (GRCm39) Y223F probably benign Het
Prss39 A G 1: 34,541,228 (GRCm39) D244G probably damaging Het
Ptx4 A T 17: 25,342,077 (GRCm39) Q184L possibly damaging Het
Slc26a1 A T 5: 108,819,611 (GRCm39) D545E probably damaging Het
Slc7a12 T C 3: 14,570,441 (GRCm39) S398P probably damaging Het
Slc9a4 T C 1: 40,639,931 (GRCm39) V241A probably damaging Het
Snw1 T C 12: 87,511,324 (GRCm39) D109G probably damaging Het
Syne2 T A 12: 75,980,674 (GRCm39) I1477K probably benign Het
Timd4 A T 11: 46,701,691 (GRCm39) Y18F probably benign Het
Tmprss2 A G 16: 97,379,797 (GRCm39) Y168H probably benign Het
Ttn A T 2: 76,569,044 (GRCm39) I27283K probably damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Vasn C T 16: 4,467,486 (GRCm39) R478C probably benign Het
Zfp58 A T 13: 67,640,082 (GRCm39) C136* probably null Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116,444,710 (GRCm39) critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116,431,740 (GRCm39) missense probably benign
R0534:Gpbp1l1 UTSW 4 116,448,465 (GRCm39) missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116,438,436 (GRCm39) splice site probably benign
R1136:Gpbp1l1 UTSW 4 116,450,115 (GRCm39) missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116,431,563 (GRCm39) missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116,428,182 (GRCm39) critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116,444,656 (GRCm39) missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116,447,462 (GRCm39) missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116,430,714 (GRCm39) missense probably benign
R5086:Gpbp1l1 UTSW 4 116,445,789 (GRCm39) missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116,447,457 (GRCm39) missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116,438,572 (GRCm39) missense probably damaging 0.99
R6604:Gpbp1l1 UTSW 4 116,430,702 (GRCm39) missense probably benign 0.09
R6973:Gpbp1l1 UTSW 4 116,438,479 (GRCm39) missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116,450,045 (GRCm39) missense probably damaging 1.00
R7286:Gpbp1l1 UTSW 4 116,447,442 (GRCm39) missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116,430,655 (GRCm39) missense probably benign 0.04
R7791:Gpbp1l1 UTSW 4 116,431,617 (GRCm39) missense probably damaging 1.00
R9475:Gpbp1l1 UTSW 4 116,431,558 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCTGCTTTGCCTACATAAATGTC -3'
(R):5'- ATTTGACTGTGAAACACGGAC -3'

Sequencing Primer
(F):5'- CTCCGATCCCTTGAGTTAGAGAG -3'
(R):5'- TTGACTGTGAAACACGGACAAACC -3'
Posted On 2019-06-26