Incidental Mutation 'R7230:Gpbp1l1'
ID562413
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene NameGC-rich promoter binding protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7230 (G1)
Quality Score224.009
Status Validated
Chromosome4
Chromosomal Location116557658-116593882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116588610 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 303 (I303N)
Ref Sequence ENSEMBL: ENSMUSP00000030460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
Predicted Effect probably damaging
Transcript: ENSMUST00000030460
AA Change: I303N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: I303N

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106475
AA Change: I303N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: I303N

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Meta Mutation Damage Score 0.3599 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 46,117,388 D989E probably benign Het
Adad1 A G 3: 37,065,166 Y132C probably damaging Het
Adam33 A T 2: 131,053,563 C579S probably damaging Het
Adam6a A C 12: 113,545,582 Q525P probably damaging Het
Alpk3 C T 7: 81,093,294 P953L probably damaging Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Bpgm A G 6: 34,487,567 E73G possibly damaging Het
Cab39 T A 1: 85,848,159 probably null Het
Ccdc162 A G 10: 41,678,813 L285P probably damaging Het
Ccdc30 T C 4: 119,339,782 E429G possibly damaging Het
Cct3 C T 3: 88,313,260 R260W probably damaging Het
Chd1 C A 17: 15,706,937 probably null Het
Cxcr4 T G 1: 128,589,790 T45P probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dlec1 T G 9: 119,124,538 probably null Het
Dram2 T G 3: 106,572,978 Y202* probably null Het
Etl4 C A 2: 20,797,988 T1035K probably damaging Het
F5 T C 1: 164,184,953 F479L probably benign Het
Fam172a G A 13: 77,759,472 E5K probably damaging Het
Frrs1l C A 4: 56,972,372 G110W probably damaging Het
Grik5 A G 7: 25,023,070 F538S probably damaging Het
Hgsnat C A 8: 25,954,832 probably null Het
Hs2st1 T C 3: 144,434,546 D338G probably benign Het
Impdh1 T C 6: 29,206,063 probably null Het
Ipo9 T C 1: 135,406,758 probably benign Het
Kdm4b T G 17: 56,369,155 L220R probably damaging Het
Map1a T A 2: 121,300,818 F705Y probably damaging Het
Med22 C T 2: 26,908,211 D99N probably benign Het
Muc6 T C 7: 141,649,214 Y519C probably damaging Het
Myt1l A G 12: 29,783,874 I25M probably damaging Het
Ncam1 T A 9: 49,509,823 I731F probably benign Het
Nlrp4f T A 13: 65,194,901 H310L probably benign Het
Olfr1286 A T 2: 111,420,916 F12I probably damaging Het
Olfr1306 T A 2: 111,912,561 Y123F probably damaging Het
Olfr694 A T 7: 106,689,524 M69K possibly damaging Het
Olfr701 C A 7: 106,818,179 T32K possibly damaging Het
Prl8a6 T A 13: 27,433,038 Y223F probably benign Het
Prss39 A G 1: 34,502,147 D244G probably damaging Het
Ptx4 A T 17: 25,123,103 Q184L possibly damaging Het
Slc26a1 A T 5: 108,671,745 D545E probably damaging Het
Slc7a12 T C 3: 14,505,381 S398P probably damaging Het
Slc9a4 T C 1: 40,600,771 V241A probably damaging Het
Snw1 T C 12: 87,464,554 D109G probably damaging Het
Syne2 T A 12: 75,933,900 I1477K probably benign Het
Timd4 A T 11: 46,810,864 Y18F probably benign Het
Tmprss2 A G 16: 97,578,597 Y168H probably benign Het
Ttn A T 2: 76,738,700 I27283K probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vasn C T 16: 4,649,622 R478C probably benign Het
Zfp58 A T 13: 67,491,963 C136* probably null Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116587513 critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116574543 missense probably benign
R0534:Gpbp1l1 UTSW 4 116591268 missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116581239 splice site probably benign
R1136:Gpbp1l1 UTSW 4 116592918 missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116574366 missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116570985 critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116587459 missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116590265 missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116573517 missense probably benign
R5086:Gpbp1l1 UTSW 4 116588592 missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116590260 missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116581375 missense probably damaging 0.99
R6604:Gpbp1l1 UTSW 4 116573505 missense probably benign 0.09
R6973:Gpbp1l1 UTSW 4 116581282 missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116592848 missense probably damaging 1.00
R7286:Gpbp1l1 UTSW 4 116590245 missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116573458 missense probably benign 0.04
R7791:Gpbp1l1 UTSW 4 116574420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTTTGCCTACATAAATGTC -3'
(R):5'- ATTTGACTGTGAAACACGGAC -3'

Sequencing Primer
(F):5'- CTCCGATCCCTTGAGTTAGAGAG -3'
(R):5'- TTGACTGTGAAACACGGACAAACC -3'
Posted On2019-06-26