Mutagenetix > Incidental Mutation

Incidental Mutation 'R7230:Grik5'

562417

Institutional Source

Beutler Lab

Gene Symbol

Grik5

Ensembl Gene

ENSMUSG00000003378

Gene Name

glutamate receptor, ionotropic, kainate 5 (gamma 2)

Synonyms

GluRgamma2, KA2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R7230 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25009849-25072346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25023070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 538 (F538S)

Ref Sequence

ENSEMBL: ENSMUSP00000003468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]

AlphaFold

Q61626

Predicted Effect

probably damaging
Transcript: ENSMUST00000003468
AA Change: F538S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: F538S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	40	381	3.4e-64	PFAM
PBPe	416	785	3.7e-122	SMART
Lig_chan-Glu_bd	426	490	1.65e-29	SMART
transmembrane domain	804	823	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
low complexity region	893	921	N/A	INTRINSIC
low complexity region	962	973	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205328

Predicted Effect

probably benign
Transcript: ENSMUST00000206134

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	C	7: 46,117,388	D989E	probably benign	Het
Adad1	A	G	3: 37,065,166	Y132C	probably damaging	Het
Adam33	A	T	2: 131,053,563	C579S	probably damaging	Het
Adam6a	A	C	12: 113,545,582	Q525P	probably damaging	Het
Alpk3	C	T	7: 81,093,294	P953L	probably damaging	Het
Atat1	A	G	17: 35,909,439	S54P	probably damaging	Het
Bpgm	A	G	6: 34,487,567	E73G	possibly damaging	Het
Cab39	T	A	1: 85,848,159		probably null	Het
Ccdc162	A	G	10: 41,678,813	L285P	probably damaging	Het
Ccdc30	T	C	4: 119,339,782	E429G	possibly damaging	Het
Cct3	C	T	3: 88,313,260	R260W	probably damaging	Het
Chd1	C	A	17: 15,706,937		probably null	Het
Cxcr4	T	G	1: 128,589,790	T45P	probably damaging	Het
Disp2	G	T	2: 118,791,805	R1006L	probably damaging	Het
Dlec1	T	G	9: 119,124,538		probably null	Het
Dram2	T	G	3: 106,572,978	Y202*	probably null	Het
Etl4	C	A	2: 20,797,988	T1035K	probably damaging	Het
F5	T	C	1: 164,184,953	F479L	probably benign	Het
Fam172a	G	A	13: 77,759,472	E5K	probably damaging	Het
Frrs1l	C	A	4: 56,972,372	G110W	probably damaging	Het
Gpbp1l1	T	A	4: 116,588,610	I303N	probably damaging	Het
Hgsnat	C	A	8: 25,954,832		probably null	Het
Hs2st1	T	C	3: 144,434,546	D338G	probably benign	Het
Impdh1	T	C	6: 29,206,063		probably null	Het
Ipo9	T	C	1: 135,406,758		probably benign	Het
Kdm4b	T	G	17: 56,369,155	L220R	probably damaging	Het
Map1a	T	A	2: 121,300,818	F705Y	probably damaging	Het
Med22	C	T	2: 26,908,211	D99N	probably benign	Het
Muc6	T	C	7: 141,649,214	Y519C	probably damaging	Het
Myt1l	A	G	12: 29,783,874	I25M	probably damaging	Het
Ncam1	T	A	9: 49,509,823	I731F	probably benign	Het
Nlrp4f	T	A	13: 65,194,901	H310L	probably benign	Het
Olfr1286	A	T	2: 111,420,916	F12I	probably damaging	Het
Olfr1306	T	A	2: 111,912,561	Y123F	probably damaging	Het
Olfr694	A	T	7: 106,689,524	M69K	possibly damaging	Het
Olfr701	C	A	7: 106,818,179	T32K	possibly damaging	Het
Prl8a6	T	A	13: 27,433,038	Y223F	probably benign	Het
Prss39	A	G	1: 34,502,147	D244G	probably damaging	Het
Ptx4	A	T	17: 25,123,103	Q184L	possibly damaging	Het
Slc26a1	A	T	5: 108,671,745	D545E	probably damaging	Het
Slc7a12	T	C	3: 14,505,381	S398P	probably damaging	Het
Slc9a4	T	C	1: 40,600,771	V241A	probably damaging	Het
Snw1	T	C	12: 87,464,554	D109G	probably damaging	Het
Syne2	T	A	12: 75,933,900	I1477K	probably benign	Het
Timd4	A	T	11: 46,810,864	Y18F	probably benign	Het
Tmprss2	A	G	16: 97,578,597	Y168H	probably benign	Het
Ttn	A	T	2: 76,738,700	I27283K	probably damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Vasn	C	T	16: 4,649,622	R478C	probably benign	Het
Zfp58	A	T	13: 67,491,963	C136*	probably null	Het

Other mutations in Grik5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Grik5	APN	7	25065393	missense	probably damaging	1.00
IGL00974:Grik5	APN	7	25013885	missense	probably damaging	1.00
IGL01941:Grik5	APN	7	25065182	missense	probably damaging	1.00
IGL02642:Grik5	APN	7	25058983	missense	possibly damaging	0.51
IGL03177:Grik5	APN	7	25015454	missense	probably damaging	1.00
IGL03402:Grik5	APN	7	25015469	missense	probably damaging	1.00
Griffin	UTSW	7	25059077	missense	possibly damaging	0.78
G1citation:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
PIT4453001:Grik5	UTSW	7	25010694	missense	probably damaging	0.99
R0077:Grik5	UTSW	7	25023380	missense	probably damaging	1.00
R0412:Grik5	UTSW	7	25013674	missense	possibly damaging	0.59
R0427:Grik5	UTSW	7	25058498	missense	probably benign	0.34
R1191:Grik5	UTSW	7	25058325	nonsense	probably null
R1830:Grik5	UTSW	7	25046301	missense	possibly damaging	0.94
R2072:Grik5	UTSW	7	25015313	missense	possibly damaging	0.92
R2369:Grik5	UTSW	7	25058537	missense	probably damaging	1.00
R3410:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3411:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3615:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R3616:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R4600:Grik5	UTSW	7	25068064	missense	probably damaging	0.99
R4658:Grik5	UTSW	7	25060727	splice site	probably benign
R4735:Grik5	UTSW	7	25058288	missense	probably damaging	1.00
R4810:Grik5	UTSW	7	25015497	missense	probably damaging	0.98
R5113:Grik5	UTSW	7	25015527	missense	probably damaging	1.00
R5120:Grik5	UTSW	7	25010640	missense	probably damaging	1.00
R5132:Grik5	UTSW	7	25065204	missense	probably benign	0.02
R5173:Grik5	UTSW	7	25062894	missense	possibly damaging	0.76
R5186:Grik5	UTSW	7	25015819	missense	probably damaging	1.00
R5239:Grik5	UTSW	7	25065470	missense	probably damaging	1.00
R5935:Grik5	UTSW	7	25059077	missense	possibly damaging	0.78
R6335:Grik5	UTSW	7	25013594	missense	probably benign
R6609:Grik5	UTSW	7	25015526	nonsense	probably null
R6760:Grik5	UTSW	7	25058939	critical splice donor site	probably null
R6820:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6821:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6822:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6824:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R7173:Grik5	UTSW	7	25068162	missense	probably damaging	1.00
R7555:Grik5	UTSW	7	25060597	missense	probably benign
R7560:Grik5	UTSW	7	25058526	missense	probably damaging	0.99
R7571:Grik5	UTSW	7	25013885	missense	possibly damaging	0.87
R8228:Grik5	UTSW	7	25010508	missense	probably damaging	1.00
R8228:Grik5	UTSW	7	25046310	missense	possibly damaging	0.93
R8681:Grik5	UTSW	7	25010472	missense	probably benign	0.06
R8879:Grik5	UTSW	7	25023064	missense	possibly damaging	0.95
R8933:Grik5	UTSW	7	25023318	missense	probably benign	0.11
R9129:Grik5	UTSW	7	25068004	splice site	probably benign
R9130:Grik5	UTSW	7	25068004	splice site	probably benign
R9154:Grik5	UTSW	7	25058978	missense	probably damaging	1.00
R9317:Grik5	UTSW	7	25046235	missense	probably damaging	0.99
R9355:Grik5	UTSW	7	25068172	missense	possibly damaging	0.82
R9406:Grik5	UTSW	7	25058544	missense	probably benign	0.00
X0017:Grik5	UTSW	7	25060588	missense	probably damaging	1.00
Z1176:Grik5	UTSW	7	25013804	missense	probably damaging	0.98
Z1177:Grik5	UTSW	7	25015825	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTGTTCAGCCAACAGAAG -3'
(R):5'- ACATGGTATGTCTCCCTGGG -3'

Sequencing Primer
(F):5'- TGTTCAGCCAACAGAAGAGGGAC -3'
(R):5'- AGTGGCTGTGACCTAGCACAG -3'

Posted On

2019-06-26