Incidental Mutation 'R0576:Gtse1'
ID 56242
Institutional Source Beutler Lab
Gene Symbol Gtse1
Ensembl Gene ENSMUSG00000022385
Gene Name G two S phase expressed protein 1
Synonyms B99, Gtse-1
MMRRC Submission 038766-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R0576 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 85859745-85876573 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85869051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 456 (S456P)
Ref Sequence ENSEMBL: ENSMUSP00000155552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170629] [ENSMUST00000231074]
AlphaFold Q8R080
Predicted Effect probably damaging
Transcript: ENSMUST00000170629
AA Change: S456P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: S456P

DomainStartEndE-ValueType
Pfam:GTSE1_N 10 153 3e-62 PFAM
low complexity region 284 301 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
low complexity region 478 497 N/A INTRINSIC
low complexity region 568 593 N/A INTRINSIC
low complexity region 644 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231074
AA Change: S456P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1950 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Gtse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gtse1 APN 15 85868817 missense possibly damaging 0.54
IGL01344:Gtse1 APN 15 85862066 critical splice acceptor site probably null
IGL01541:Gtse1 APN 15 85875654 nonsense probably null
IGL01621:Gtse1 APN 15 85875082 missense probably benign 0.01
IGL01945:Gtse1 APN 15 85871547 missense probably benign 0.00
IGL02193:Gtse1 APN 15 85862330 missense probably benign 0.27
IGL02215:Gtse1 APN 15 85862598 missense possibly damaging 0.92
IGL02494:Gtse1 APN 15 85867503 missense probably damaging 1.00
IGL02879:Gtse1 APN 15 85869063 splice site probably benign
R0009:Gtse1 UTSW 15 85862435 missense probably benign 0.06
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R1078:Gtse1 UTSW 15 85862307 missense probably damaging 0.98
R1442:Gtse1 UTSW 15 85860102 splice site probably benign
R1623:Gtse1 UTSW 15 85867578 missense probably benign
R1925:Gtse1 UTSW 15 85873738 missense probably benign 0.00
R1928:Gtse1 UTSW 15 85862063 splice site probably benign
R4565:Gtse1 UTSW 15 85875184 missense probably damaging 0.99
R5170:Gtse1 UTSW 15 85864264 critical splice donor site probably null
R5310:Gtse1 UTSW 15 85873792 missense probably benign 0.04
R5428:Gtse1 UTSW 15 85862139 missense probably benign 0.12
R5748:Gtse1 UTSW 15 85867577 missense probably benign
R5996:Gtse1 UTSW 15 85864180 missense probably benign 0.00
R6179:Gtse1 UTSW 15 85868957 missense possibly damaging 0.95
R6379:Gtse1 UTSW 15 85864224 missense probably benign 0.01
R6381:Gtse1 UTSW 15 85862148 missense probably benign 0.00
R6434:Gtse1 UTSW 15 85875169 missense probably benign 0.21
R7086:Gtse1 UTSW 15 85875549 missense probably damaging 1.00
R7304:Gtse1 UTSW 15 85871547 missense probably benign 0.00
R7485:Gtse1 UTSW 15 85868700 missense probably benign 0.04
R7580:Gtse1 UTSW 15 85862231 missense probably damaging 1.00
R7856:Gtse1 UTSW 15 85864141 missense probably benign 0.09
R8496:Gtse1 UTSW 15 85862082 missense probably damaging 1.00
R8674:Gtse1 UTSW 15 85862175 missense probably damaging 1.00
R8987:Gtse1 UTSW 15 85868908 missense probably benign 0.00
R9491:Gtse1 UTSW 15 85871533 missense probably damaging 1.00
R9642:Gtse1 UTSW 15 85867496 missense probably damaging 0.98
Z1176:Gtse1 UTSW 15 85868746 missense possibly damaging 0.85
Z1177:Gtse1 UTSW 15 85875737 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATAAGGCTGATGCTGCCCAGAC -3'
(R):5'- GCATTCACTGGCTGCCAAGTTC -3'

Sequencing Primer
(F):5'- ATGCTGCCCAGACAGTGG -3'
(R):5'- TCTAACCCCAGGTGCGAC -3'
Posted On 2013-07-11