Incidental Mutation 'R7230:Timd4'
ID562425
Institutional Source Beutler Lab
Gene Symbol Timd4
Ensembl Gene ENSMUSG00000055546
Gene NameT cell immunoglobulin and mucin domain containing 4
SynonymsTim4, B430010N18Rik, TIM-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7230 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46810800-46844332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46810864 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 18 (Y18F)
Ref Sequence ENSEMBL: ENSMUSP00000069456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068877]
PDB Structure
Tim-4 [X-RAY DIFFRACTION]
Tim-4 in complex with sodium potassium tartrate [X-RAY DIFFRACTION]
Tim-4 in complex with phosphatidylserine [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000068877
AA Change: Y18F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069456
Gene: ENSMUSG00000055546
AA Change: Y18F

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
IG 25 132 3.59e-5 SMART
low complexity region 135 182 N/A INTRINSIC
low complexity region 248 271 N/A INTRINSIC
transmembrane domain 279 301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage phagocytosis, altered macrophage physiology, and increased peritoneal lymphoid and meyloid cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 46,117,388 D989E probably benign Het
Adad1 A G 3: 37,065,166 Y132C probably damaging Het
Adam33 A T 2: 131,053,563 C579S probably damaging Het
Adam6a A C 12: 113,545,582 Q525P probably damaging Het
Alpk3 C T 7: 81,093,294 P953L probably damaging Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Bpgm A G 6: 34,487,567 E73G possibly damaging Het
Cab39 T A 1: 85,848,159 probably null Het
Ccdc162 A G 10: 41,678,813 L285P probably damaging Het
Ccdc30 T C 4: 119,339,782 E429G possibly damaging Het
Cct3 C T 3: 88,313,260 R260W probably damaging Het
Chd1 C A 17: 15,706,937 probably null Het
Cxcr4 T G 1: 128,589,790 T45P probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dlec1 T G 9: 119,124,538 probably null Het
Dram2 T G 3: 106,572,978 Y202* probably null Het
Etl4 C A 2: 20,797,988 T1035K probably damaging Het
F5 T C 1: 164,184,953 F479L probably benign Het
Fam172a G A 13: 77,759,472 E5K probably damaging Het
Frrs1l C A 4: 56,972,372 G110W probably damaging Het
Gpbp1l1 T A 4: 116,588,610 I303N probably damaging Het
Grik5 A G 7: 25,023,070 F538S probably damaging Het
Hgsnat C A 8: 25,954,832 probably null Het
Hs2st1 T C 3: 144,434,546 D338G probably benign Het
Impdh1 T C 6: 29,206,063 probably null Het
Ipo9 T C 1: 135,406,758 probably benign Het
Kdm4b T G 17: 56,369,155 L220R probably damaging Het
Map1a T A 2: 121,300,818 F705Y probably damaging Het
Med22 C T 2: 26,908,211 D99N probably benign Het
Muc6 T C 7: 141,649,214 Y519C probably damaging Het
Myt1l A G 12: 29,783,874 I25M probably damaging Het
Ncam1 T A 9: 49,509,823 I731F probably benign Het
Nlrp4f T A 13: 65,194,901 H310L probably benign Het
Olfr1286 A T 2: 111,420,916 F12I probably damaging Het
Olfr1306 T A 2: 111,912,561 Y123F probably damaging Het
Olfr694 A T 7: 106,689,524 M69K possibly damaging Het
Olfr701 C A 7: 106,818,179 T32K possibly damaging Het
Prl8a6 T A 13: 27,433,038 Y223F probably benign Het
Prss39 A G 1: 34,502,147 D244G probably damaging Het
Ptx4 A T 17: 25,123,103 Q184L possibly damaging Het
Slc26a1 A T 5: 108,671,745 D545E probably damaging Het
Slc7a12 T C 3: 14,505,381 S398P probably damaging Het
Slc9a4 T C 1: 40,600,771 V241A probably damaging Het
Snw1 T C 12: 87,464,554 D109G probably damaging Het
Syne2 T A 12: 75,933,900 I1477K probably benign Het
Tmprss2 A G 16: 97,578,597 Y168H probably benign Het
Ttn A T 2: 76,738,700 I27283K probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vasn C T 16: 4,649,622 R478C probably benign Het
Zfp58 A T 13: 67,491,963 C136* probably null Het
Other mutations in Timd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Timd4 APN 11 46820014 missense possibly damaging 0.61
IGL02247:Timd4 APN 11 46815731 missense probably damaging 1.00
IGL02803:Timd4 APN 11 46815694 missense probably damaging 1.00
IGL02991:Timd4 APN 11 46842147 splice site probably benign
R0318:Timd4 UTSW 11 46837071 missense probably benign 0.00
R0427:Timd4 UTSW 11 46819257 missense probably benign 0.00
R1175:Timd4 UTSW 11 46817671 missense probably damaging 1.00
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1635:Timd4 UTSW 11 46842162 missense possibly damaging 0.92
R2011:Timd4 UTSW 11 46820030 missense possibly damaging 0.79
R2012:Timd4 UTSW 11 46820030 missense possibly damaging 0.79
R4994:Timd4 UTSW 11 46815517 missense probably damaging 0.99
R5511:Timd4 UTSW 11 46819980 splice site probably null
R5739:Timd4 UTSW 11 46817746 missense probably benign 0.10
R5991:Timd4 UTSW 11 46843203 makesense probably null
R6207:Timd4 UTSW 11 46815526 missense probably damaging 0.98
R6863:Timd4 UTSW 11 46815443 nonsense probably null
R7254:Timd4 UTSW 11 46843189 missense probably benign 0.04
R7466:Timd4 UTSW 11 46817758 missense probably benign 0.01
R7750:Timd4 UTSW 11 46815527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACCATGAGAAAAGTGCC -3'
(R):5'- TGCTTTGTACCACTTGCAGATG -3'

Sequencing Primer
(F):5'- TTGATCACACATCCCAGATTGAGG -3'
(R):5'- TGTACCACTTGCAGATGAAATTG -3'
Posted On2019-06-26