Incidental Mutation 'R0576:Olfr166'
ID56243
Institutional Source Beutler Lab
Gene Symbol Olfr166
Ensembl Gene ENSMUSG00000056822
Gene Nameolfactory receptor 166
SynonymsGA_x54KRFPKG5P-15934912-15935850, MOR270-1
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0576 (G1)
Quality Score197
Status Validated
Chromosome16
Chromosomal Location19483694-19489882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19487188 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 117 (M117V)
Ref Sequence ENSEMBL: ENSMUSP00000150764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074739] [ENSMUST00000213531] [ENSMUST00000216465]
Predicted Effect probably damaging
Transcript: ENSMUST00000074739
AA Change: M117V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074299
Gene: ENSMUSG00000056822
AA Change: M117V

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:7tm_4 30 306 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 295 3.6e-7 PFAM
Pfam:7tm_1 40 289 2.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213531
AA Change: M117V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216465
AA Change: M117V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2432 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Olfr166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Olfr166 APN 16 19487459 missense probably benign 0.13
IGL01639:Olfr166 APN 16 19487164 missense probably damaging 0.97
IGL02105:Olfr166 APN 16 19487261 missense probably benign 0.15
IGL02352:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL02359:Olfr166 APN 16 19487177 missense probably damaging 1.00
IGL03053:Olfr166 APN 16 19487219 missense probably benign 0.36
IGL03168:Olfr166 APN 16 19487219 missense probably benign 0.36
R0920:Olfr166 UTSW 16 19486930 missense probably benign 0.00
R1335:Olfr166 UTSW 16 19487053 missense probably benign 0.01
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1468:Olfr166 UTSW 16 19487628 missense probably benign 0.15
R1490:Olfr166 UTSW 16 19486922 missense probably benign
R2095:Olfr166 UTSW 16 19486931 missense probably benign
R3123:Olfr166 UTSW 16 19487015 missense probably damaging 1.00
R4893:Olfr166 UTSW 16 19486903 missense probably benign
R5093:Olfr166 UTSW 16 19487477 missense probably damaging 1.00
R5222:Olfr166 UTSW 16 19486930 missense probably benign
R7149:Olfr166 UTSW 16 19487510 missense probably damaging 1.00
R7305:Olfr166 UTSW 16 19487699 missense probably damaging 0.98
R7484:Olfr166 UTSW 16 19487003 missense possibly damaging 0.82
X0020:Olfr166 UTSW 16 19487090 missense probably benign 0.22
Z1088:Olfr166 UTSW 16 19487048 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GGCAACTCAGGAATGATCCACCTC -3'
(R):5'- GGCAACATGGCTGGAACATCACAG -3'

Sequencing Primer
(F):5'- AGGAATGATCCACCTCATTCGTG -3'
(R):5'- CATCACAGAAGAAATGGTTAATGGAC -3'
Posted On2013-07-11