Incidental Mutation 'R7230:Prl8a6'
ID562430
Institutional Source Beutler Lab
Gene Symbol Prl8a6
Ensembl Gene ENSMUSG00000021345
Gene Nameprolactin family 8, subfamily a, member 6
SynonymsPrlpc1, PLP-Ca, PLP-calpha, Prlpc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R7230 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location27432681-27438688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27433038 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 223 (Y223F)
Ref Sequence ENSEMBL: ENSMUSP00000105984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018392] [ENSMUST00000080762] [ENSMUST00000110355]
Predicted Effect probably benign
Transcript: ENSMUST00000018392
AA Change: Y222F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018392
Gene: ENSMUSG00000021345
AA Change: Y222F

DomainStartEndE-ValueType
Pfam:Hormone_1 16 239 2.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080762
AA Change: Y188F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079584
Gene: ENSMUSG00000021345
AA Change: Y188F

DomainStartEndE-ValueType
Pfam:Hormone_1 17 86 1.9e-13 PFAM
Pfam:Hormone_1 83 205 2.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110355
AA Change: Y223F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105984
Gene: ENSMUSG00000021345
AA Change: Y223F

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 46,117,388 D989E probably benign Het
Adad1 A G 3: 37,065,166 Y132C probably damaging Het
Adam33 A T 2: 131,053,563 C579S probably damaging Het
Adam6a A C 12: 113,545,582 Q525P probably damaging Het
Alpk3 C T 7: 81,093,294 P953L probably damaging Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Bpgm A G 6: 34,487,567 E73G possibly damaging Het
Cab39 T A 1: 85,848,159 probably null Het
Ccdc162 A G 10: 41,678,813 L285P probably damaging Het
Ccdc30 T C 4: 119,339,782 E429G possibly damaging Het
Cct3 C T 3: 88,313,260 R260W probably damaging Het
Chd1 C A 17: 15,706,937 probably null Het
Cxcr4 T G 1: 128,589,790 T45P probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dlec1 T G 9: 119,124,538 probably null Het
Dram2 T G 3: 106,572,978 Y202* probably null Het
Etl4 C A 2: 20,797,988 T1035K probably damaging Het
F5 T C 1: 164,184,953 F479L probably benign Het
Fam172a G A 13: 77,759,472 E5K probably damaging Het
Frrs1l C A 4: 56,972,372 G110W probably damaging Het
Gpbp1l1 T A 4: 116,588,610 I303N probably damaging Het
Grik5 A G 7: 25,023,070 F538S probably damaging Het
Hgsnat C A 8: 25,954,832 probably null Het
Hs2st1 T C 3: 144,434,546 D338G probably benign Het
Impdh1 T C 6: 29,206,063 probably null Het
Ipo9 T C 1: 135,406,758 probably benign Het
Kdm4b T G 17: 56,369,155 L220R probably damaging Het
Map1a T A 2: 121,300,818 F705Y probably damaging Het
Med22 C T 2: 26,908,211 D99N probably benign Het
Muc6 T C 7: 141,649,214 Y519C probably damaging Het
Myt1l A G 12: 29,783,874 I25M probably damaging Het
Ncam1 T A 9: 49,509,823 I731F probably benign Het
Nlrp4f T A 13: 65,194,901 H310L probably benign Het
Olfr1286 A T 2: 111,420,916 F12I probably damaging Het
Olfr1306 T A 2: 111,912,561 Y123F probably damaging Het
Olfr694 A T 7: 106,689,524 M69K possibly damaging Het
Olfr701 C A 7: 106,818,179 T32K possibly damaging Het
Prss39 A G 1: 34,502,147 D244G probably damaging Het
Ptx4 A T 17: 25,123,103 Q184L possibly damaging Het
Slc26a1 A T 5: 108,671,745 D545E probably damaging Het
Slc7a12 T C 3: 14,505,381 S398P probably damaging Het
Slc9a4 T C 1: 40,600,771 V241A probably damaging Het
Snw1 T C 12: 87,464,554 D109G probably damaging Het
Syne2 T A 12: 75,933,900 I1477K probably benign Het
Timd4 A T 11: 46,810,864 Y18F probably benign Het
Tmprss2 A G 16: 97,578,597 Y168H probably benign Het
Ttn A T 2: 76,738,700 I27283K probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vasn C T 16: 4,649,622 R478C probably benign Het
Zfp58 A T 13: 67,491,963 C136* probably null Het
Other mutations in Prl8a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0157:Prl8a6 UTSW 13 27436179 splice site probably benign
R0115:Prl8a6 UTSW 13 27433101 missense probably benign 0.07
R0481:Prl8a6 UTSW 13 27433101 missense probably benign 0.07
R0514:Prl8a6 UTSW 13 27433007 nonsense probably null
R2209:Prl8a6 UTSW 13 27435386 missense probably benign 0.03
R2329:Prl8a6 UTSW 13 27437067 missense probably benign
R3876:Prl8a6 UTSW 13 27433032 nonsense probably null
R5259:Prl8a6 UTSW 13 27436196 nonsense probably null
R5800:Prl8a6 UTSW 13 27435470 missense probably benign
R5921:Prl8a6 UTSW 13 27437188 missense probably damaging 1.00
R6901:Prl8a6 UTSW 13 27437047 missense possibly damaging 0.87
R7182:Prl8a6 UTSW 13 27437170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGCCTGAATGTTATGGAG -3'
(R):5'- CTGATTGCACACAGACAATATAAGG -3'

Sequencing Primer
(F):5'- TAGGATACATGTATCAGCTGATGAG -3'
(R):5'- TGCACACAGACAATATAAGGAGAAAG -3'
Posted On2019-06-26