Incidental Mutation 'R7230:Zfp58'
ID562432
Institutional Source Beutler Lab
Gene Symbol Zfp58
Ensembl Gene ENSMUSG00000071291
Gene Namezinc finger protein 58
SynonymsZfp817, Mfg-1, A530094I17Rik, Mfg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7230 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67490167-67500555 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 67491963 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 136 (C136*)
Ref Sequence ENSEMBL: ENSMUSP00000075487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076123] [ENSMUST00000091523] [ENSMUST00000163534] [ENSMUST00000167914] [ENSMUST00000171518]
Predicted Effect probably null
Transcript: ENSMUST00000076123
AA Change: C136*
SMART Domains Protein: ENSMUSP00000075487
Gene: ENSMUSG00000071291
AA Change: C136*

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
ZnF_C2H2 246 268 2.91e-2 SMART
ZnF_C2H2 274 296 9.73e-4 SMART
ZnF_C2H2 302 324 6.23e-2 SMART
ZnF_C2H2 330 352 1.03e-2 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 386 408 2.99e-4 SMART
ZnF_C2H2 410 432 4.87e-4 SMART
ZnF_C2H2 438 460 2.75e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091523
AA Change: C136*
SMART Domains Protein: ENSMUSP00000089108
Gene: ENSMUSG00000071291
AA Change: C136*

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163534
AA Change: C136*
SMART Domains Protein: ENSMUSP00000129177
Gene: ENSMUSG00000071291
AA Change: C136*

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167914
SMART Domains Protein: ENSMUSP00000137830
Gene: ENSMUSG00000097565

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171518
AA Change: C136*
SMART Domains Protein: ENSMUSP00000132285
Gene: ENSMUSG00000071291
AA Change: C136*

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
ZnF_C2H2 246 268 2.91e-2 SMART
ZnF_C2H2 274 296 9.73e-4 SMART
ZnF_C2H2 302 324 6.23e-2 SMART
ZnF_C2H2 330 352 1.03e-2 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 386 408 2.99e-4 SMART
ZnF_C2H2 410 432 4.87e-4 SMART
ZnF_C2H2 438 460 2.75e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 46,117,388 D989E probably benign Het
Adad1 A G 3: 37,065,166 Y132C probably damaging Het
Adam33 A T 2: 131,053,563 C579S probably damaging Het
Adam6a A C 12: 113,545,582 Q525P probably damaging Het
Alpk3 C T 7: 81,093,294 P953L probably damaging Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Bpgm A G 6: 34,487,567 E73G possibly damaging Het
Cab39 T A 1: 85,848,159 probably null Het
Ccdc162 A G 10: 41,678,813 L285P probably damaging Het
Ccdc30 T C 4: 119,339,782 E429G possibly damaging Het
Cct3 C T 3: 88,313,260 R260W probably damaging Het
Chd1 C A 17: 15,706,937 probably null Het
Cxcr4 T G 1: 128,589,790 T45P probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dlec1 T G 9: 119,124,538 probably null Het
Dram2 T G 3: 106,572,978 Y202* probably null Het
Etl4 C A 2: 20,797,988 T1035K probably damaging Het
F5 T C 1: 164,184,953 F479L probably benign Het
Fam172a G A 13: 77,759,472 E5K probably damaging Het
Frrs1l C A 4: 56,972,372 G110W probably damaging Het
Gpbp1l1 T A 4: 116,588,610 I303N probably damaging Het
Grik5 A G 7: 25,023,070 F538S probably damaging Het
Hgsnat C A 8: 25,954,832 probably null Het
Hs2st1 T C 3: 144,434,546 D338G probably benign Het
Impdh1 T C 6: 29,206,063 probably null Het
Ipo9 T C 1: 135,406,758 probably benign Het
Kdm4b T G 17: 56,369,155 L220R probably damaging Het
Map1a T A 2: 121,300,818 F705Y probably damaging Het
Med22 C T 2: 26,908,211 D99N probably benign Het
Muc6 T C 7: 141,649,214 Y519C probably damaging Het
Myt1l A G 12: 29,783,874 I25M probably damaging Het
Ncam1 T A 9: 49,509,823 I731F probably benign Het
Nlrp4f T A 13: 65,194,901 H310L probably benign Het
Olfr1286 A T 2: 111,420,916 F12I probably damaging Het
Olfr1306 T A 2: 111,912,561 Y123F probably damaging Het
Olfr694 A T 7: 106,689,524 M69K possibly damaging Het
Olfr701 C A 7: 106,818,179 T32K possibly damaging Het
Prl8a6 T A 13: 27,433,038 Y223F probably benign Het
Prss39 A G 1: 34,502,147 D244G probably damaging Het
Ptx4 A T 17: 25,123,103 Q184L possibly damaging Het
Slc26a1 A T 5: 108,671,745 D545E probably damaging Het
Slc7a12 T C 3: 14,505,381 S398P probably damaging Het
Slc9a4 T C 1: 40,600,771 V241A probably damaging Het
Snw1 T C 12: 87,464,554 D109G probably damaging Het
Syne2 T A 12: 75,933,900 I1477K probably benign Het
Timd4 A T 11: 46,810,864 Y18F probably benign Het
Tmprss2 A G 16: 97,578,597 Y168H probably benign Het
Ttn A T 2: 76,738,700 I27283K probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vasn C T 16: 4,649,622 R478C probably benign Het
Other mutations in Zfp58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfp58 APN 13 67490995 missense probably benign 0.29
IGL02618:Zfp58 APN 13 67491356 missense possibly damaging 0.92
IGL03188:Zfp58 APN 13 67491409 missense probably benign 0.03
R0535:Zfp58 UTSW 13 67492082 nonsense probably null
R1470:Zfp58 UTSW 13 67492025 missense possibly damaging 0.71
R1470:Zfp58 UTSW 13 67492025 missense possibly damaging 0.71
R1750:Zfp58 UTSW 13 67491479 nonsense probably null
R1862:Zfp58 UTSW 13 67491188 missense probably damaging 1.00
R2697:Zfp58 UTSW 13 67491005 missense probably damaging 1.00
R3031:Zfp58 UTSW 13 67492112 missense probably benign 0.06
R3033:Zfp58 UTSW 13 67491622 missense probably damaging 1.00
R4200:Zfp58 UTSW 13 67491321 missense probably benign 0.25
R5827:Zfp58 UTSW 13 67491293 missense probably damaging 0.99
R6723:Zfp58 UTSW 13 67494073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCAGAATGACGCAATTTA -3'
(R):5'- AATGTAAAGATTTCAGCAAGGCC -3'

Sequencing Primer
(F):5'- ACATTCTGCACACTTGTAGGG -3'
(R):5'- GGGAGAAAGCCTTCAAGT -3'
Posted On2019-06-26