Incidental Mutation 'R7230:Ptx4'
ID562437
Institutional Source Beutler Lab
Gene Symbol Ptx4
Ensembl Gene ENSMUSG00000044172
Gene Namepentraxin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R7230 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25120760-25125268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25123103 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 184 (Q184L)
Ref Sequence ENSEMBL: ENSMUSP00000055984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054930
AA Change: Q184L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055984
Gene: ENSMUSG00000044172
AA Change: Q184L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:HOX 32 122 3e-35 BLAST
coiled coil region 147 182 N/A INTRINSIC
Pfam:Pentaxin 271 460 7.3e-33 PFAM
Pfam:Laminin_G_3 277 440 2.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the pentraxin superfamily, whose members encode highly conserved multifunctional proteins. The encoded protein, like other members of this family, contains a conserved pentraxin domain at the C-terminus. The highest levels of expression of the protein were observed in bone marrow, small intestine and testes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A C 7: 46,117,388 D989E probably benign Het
Adad1 A G 3: 37,065,166 Y132C probably damaging Het
Adam33 A T 2: 131,053,563 C579S probably damaging Het
Adam6a A C 12: 113,545,582 Q525P probably damaging Het
Alpk3 C T 7: 81,093,294 P953L probably damaging Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Bpgm A G 6: 34,487,567 E73G possibly damaging Het
Cab39 T A 1: 85,848,159 probably null Het
Ccdc162 A G 10: 41,678,813 L285P probably damaging Het
Ccdc30 T C 4: 119,339,782 E429G possibly damaging Het
Cct3 C T 3: 88,313,260 R260W probably damaging Het
Chd1 C A 17: 15,706,937 probably null Het
Cxcr4 T G 1: 128,589,790 T45P probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dlec1 T G 9: 119,124,538 probably null Het
Dram2 T G 3: 106,572,978 Y202* probably null Het
Etl4 C A 2: 20,797,988 T1035K probably damaging Het
F5 T C 1: 164,184,953 F479L probably benign Het
Fam172a G A 13: 77,759,472 E5K probably damaging Het
Frrs1l C A 4: 56,972,372 G110W probably damaging Het
Gpbp1l1 T A 4: 116,588,610 I303N probably damaging Het
Grik5 A G 7: 25,023,070 F538S probably damaging Het
Hgsnat C A 8: 25,954,832 probably null Het
Hs2st1 T C 3: 144,434,546 D338G probably benign Het
Impdh1 T C 6: 29,206,063 probably null Het
Ipo9 T C 1: 135,406,758 probably benign Het
Kdm4b T G 17: 56,369,155 L220R probably damaging Het
Map1a T A 2: 121,300,818 F705Y probably damaging Het
Med22 C T 2: 26,908,211 D99N probably benign Het
Muc6 T C 7: 141,649,214 Y519C probably damaging Het
Myt1l A G 12: 29,783,874 I25M probably damaging Het
Ncam1 T A 9: 49,509,823 I731F probably benign Het
Nlrp4f T A 13: 65,194,901 H310L probably benign Het
Olfr1286 A T 2: 111,420,916 F12I probably damaging Het
Olfr1306 T A 2: 111,912,561 Y123F probably damaging Het
Olfr694 A T 7: 106,689,524 M69K possibly damaging Het
Olfr701 C A 7: 106,818,179 T32K possibly damaging Het
Prl8a6 T A 13: 27,433,038 Y223F probably benign Het
Prss39 A G 1: 34,502,147 D244G probably damaging Het
Slc26a1 A T 5: 108,671,745 D545E probably damaging Het
Slc7a12 T C 3: 14,505,381 S398P probably damaging Het
Slc9a4 T C 1: 40,600,771 V241A probably damaging Het
Snw1 T C 12: 87,464,554 D109G probably damaging Het
Syne2 T A 12: 75,933,900 I1477K probably benign Het
Timd4 A T 11: 46,810,864 Y18F probably benign Het
Tmprss2 A G 16: 97,578,597 Y168H probably benign Het
Ttn A T 2: 76,738,700 I27283K probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vasn C T 16: 4,649,622 R478C probably benign Het
Zfp58 A T 13: 67,491,963 C136* probably null Het
Other mutations in Ptx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Ptx4 APN 17 25125048 missense possibly damaging 0.81
IGL03373:Ptx4 APN 17 25120899 missense probably benign 0.02
IGL03394:Ptx4 APN 17 25124675 missense probably damaging 1.00
R0559:Ptx4 UTSW 17 25123108 nonsense probably null
R3765:Ptx4 UTSW 17 25122868 missense probably benign 0.02
R4629:Ptx4 UTSW 17 25122763 missense probably damaging 1.00
R4677:Ptx4 UTSW 17 25123126 missense probably benign 0.05
R4938:Ptx4 UTSW 17 25123165 nonsense probably null
R5170:Ptx4 UTSW 17 25123178 missense probably benign 0.01
R5517:Ptx4 UTSW 17 25124786 missense possibly damaging 0.58
R6614:Ptx4 UTSW 17 25122702 missense possibly damaging 0.70
R6993:Ptx4 UTSW 17 25124924 missense possibly damaging 0.70
R7070:Ptx4 UTSW 17 25122997 missense probably benign 0.04
R7501:Ptx4 UTSW 17 25125192 missense possibly damaging 0.95
R7845:Ptx4 UTSW 17 25124954 missense possibly damaging 0.95
R8069:Ptx4 UTSW 17 25122779 missense probably damaging 1.00
R8244:Ptx4 UTSW 17 25122865 missense possibly damaging 0.87
R8370:Ptx4 UTSW 17 25123340 missense possibly damaging 0.90
R8388:Ptx4 UTSW 17 25120923 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGTATAGGAAGAGCCAGC -3'
(R):5'- GTGGACAGTGACGTCATGAG -3'

Sequencing Primer
(F):5'- CAGAAGGTAGATGCCCGACTTC -3'
(R):5'- TGACGTCATGAGGGGAACTCC -3'
Posted On2019-06-26