Incidental Mutation 'R0576:Ppm1b'
ID56245
Institutional Source Beutler Lab
Gene Symbol Ppm1b
Ensembl Gene ENSMUSG00000061130
Gene Nameprotein phosphatase 1B, magnesium dependent, beta isoform
SynonymsPP2CB
MMRRC Submission 038766-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0576 (G1)
Quality Score111
Status Validated
Chromosome17
Chromosomal Location84956741-85023991 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 85013559 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080217] [ENSMUST00000112304] [ENSMUST00000112305] [ENSMUST00000112307]
Predicted Effect probably null
Transcript: ENSMUST00000080217
SMART Domains Protein: ENSMUSP00000079107
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 9e-16 BLAST
low complexity region 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112304
SMART Domains Protein: ENSMUSP00000107923
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 6e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112305
SMART Domains Protein: ENSMUSP00000107924
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 6e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112307
SMART Domains Protein: ENSMUSP00000107926
Gene: ENSMUSG00000061130

DomainStartEndE-ValueType
PP2Cc 13 293 1.57e-97 SMART
PP2C_SIG 38 295 2.6e-1 SMART
Blast:PP2Cc 296 341 5e-16 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO results in early pre-implantation lethality. A hypomorphic mutation results in increased sensitivity to Tnf-induced necroptosis and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Cxxc1 T C 18: 74,220,185 I497T possibly damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Ppm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Ppm1b APN 17 85003284 missense probably damaging 1.00
IGL01923:Ppm1b APN 17 84994061 missense probably damaging 0.98
IGL02974:Ppm1b APN 17 84993824 missense possibly damaging 0.92
R0190:Ppm1b UTSW 17 84994103 missense probably damaging 1.00
R1848:Ppm1b UTSW 17 84994124 missense probably benign 0.00
R2018:Ppm1b UTSW 17 84994202 missense probably damaging 1.00
R2179:Ppm1b UTSW 17 84994434 missense probably damaging 1.00
R3053:Ppm1b UTSW 17 85013846 missense probably benign 0.00
R3085:Ppm1b UTSW 17 85013860 missense probably benign
R4387:Ppm1b UTSW 17 85015419 missense probably benign
R5353:Ppm1b UTSW 17 84994109 missense probably benign 0.17
R5738:Ppm1b UTSW 17 84993946 missense probably benign 0.14
R5818:Ppm1b UTSW 17 84993719 missense probably benign 0.01
R7588:Ppm1b UTSW 17 85013569 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTTTGCCTCGCTTTAAAACACTAGA -3'
(R):5'- GGTTTCCACCATCACTGTTCGAAGA -3'

Sequencing Primer
(F):5'- aaatccatctgcctctgcc -3'
(R):5'- TCACTGTTCGAAGAAGCAGC -3'
Posted On2013-07-11