Incidental Mutation 'R7231:Cyp4a32'
ID562451
Institutional Source Beutler Lab
Gene Symbol Cyp4a32
Ensembl Gene ENSMUSG00000063929
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 32
SynonymsOTTMUSG00000008689
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7231 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115600969-115621602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115609697 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 193 (L193P)
Ref Sequence ENSEMBL: ENSMUSP00000081369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084342]
Predicted Effect probably damaging
Transcript: ENSMUST00000084342
AA Change: L193P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081369
Gene: ENSMUSG00000063929
AA Change: L193P

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 1.3e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,294,175 T2013S probably benign Het
Ablim3 A G 18: 61,805,064 probably null Het
Acvrl1 T A 15: 101,136,223 C206* probably null Het
Adamts15 C A 9: 30,906,158 R541S probably damaging Het
Add3 A G 19: 53,233,146 I230V probably benign Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Asxl3 A T 18: 22,411,499 probably null Het
Asxl3 A G 18: 22,517,540 E862G probably damaging Het
Atp2b2 G A 6: 113,765,732 T798M possibly damaging Het
Car12 T C 9: 66,752,317 I208T probably damaging Het
Cgn T A 3: 94,773,192 Q600L probably damaging Het
Cgnl1 C T 9: 71,632,645 A1106T probably benign Het
Cmtr2 T C 8: 110,222,546 V496A probably benign Het
Cplx4 C A 18: 65,957,052 D99Y probably damaging Het
Cyfip2 T C 11: 46,224,136 T915A probably benign Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Depdc5 C A 5: 32,901,865 Q303K possibly damaging Het
Dlx1 T A 2: 71,532,496 M249K possibly damaging Het
Dnah10 A T 5: 124,813,828 E3218V probably benign Het
Dnah9 T C 11: 65,965,647 D2896G probably damaging Het
Dtx4 C A 19: 12,469,658 G557* probably null Het
Eps8l2 A G 7: 141,360,392 N512D probably damaging Het
Fam20a T C 11: 109,721,375 D114G possibly damaging Het
Fbln1 T C 15: 85,206,152 S7P unknown Het
Fli1 T C 9: 32,424,188 E316G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Haus8 G A 8: 71,253,137 T302I probably benign Het
Hmcn1 T C 1: 150,638,876 I3582V probably benign Het
Hnrnpul1 G A 7: 25,748,417 Q161* probably null Het
Hsf4 C T 8: 105,272,147 A223V probably damaging Het
Ighg2c A G 12: 113,288,016 W164R Het
Isl1 A G 13: 116,303,290 V174A probably benign Het
Itih4 A T 14: 30,896,614 I661F probably benign Het
Klhl14 A T 18: 21,652,136 L78Q probably damaging Het
L3mbtl3 T A 10: 26,339,282 I177F unknown Het
Lingo3 T A 10: 80,835,104 T331S possibly damaging Het
Lrrc36 T C 8: 105,461,057 V535A possibly damaging Het
Mapk8ip2 T G 15: 89,458,076 S497A probably benign Het
Mbip A G 12: 56,337,762 probably null Het
Nelfa C T 5: 33,898,825 G498D probably damaging Het
Nlrc5 T A 8: 94,521,805 probably null Het
Olfr1312 A T 2: 112,042,366 V222D probably damaging Het
Olfr679 T C 7: 105,085,787 S24P possibly damaging Het
Olfr701 A T 7: 106,818,443 Y120F probably damaging Het
Olfr863-ps1 T A 9: 19,941,559 T294S unknown Het
Pde2a A G 7: 101,505,953 Y567C probably damaging Het
Pdia4 A T 6: 47,800,957 F367Y probably benign Het
Pkdrej C A 15: 85,816,188 C1849F possibly damaging Het
Plekhj1 T G 10: 80,797,658 T52P probably damaging Het
Ppp2r5d A T 17: 46,684,060 Y572N probably benign Het
Prkcq T A 2: 11,290,451 Y570* probably null Het
Ptpn3 T A 4: 57,245,062 D226V probably damaging Het
Rab1b A G 19: 5,105,201 S22P probably damaging Het
Ralgapa1 A G 12: 55,604,191 S2060P probably damaging Het
Rnf148 G T 6: 23,654,891 S35R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd15 T A 12: 87,201,044 S168T possibly damaging Het
Slc26a4 T A 12: 31,547,946 N167I probably damaging Het
Slc39a1 C A 3: 90,251,790 H141Q probably benign Het
Slc9a3r2 C T 17: 24,650,104 R16H probably damaging Het
Snx21 T C 2: 164,786,201 S46P probably benign Het
Strip2 A G 6: 29,944,487 S657G probably damaging Het
Stxbp3 G A 3: 108,800,809 P392L probably damaging Het
Suclg1 G A 6: 73,263,971 R161H probably benign Het
Tas1r3 T C 4: 155,862,826 Y134C probably damaging Het
Tgif1 T A 17: 70,846,173 Q114L probably damaging Het
Tll2 A G 19: 41,086,234 F964L probably benign Het
Tmem181a T C 17: 6,297,920 S247P possibly damaging Het
Trav23 A T 14: 53,977,568 R79S probably damaging Het
Trf C A 9: 103,225,148 C177F probably damaging Het
Triml1 T C 8: 43,136,371 Y260C probably benign Het
Tulp4 T C 17: 6,236,235 F1513L probably benign Het
Umodl1 G A 17: 30,986,116 V562I probably damaging Het
Ush2a A G 1: 188,759,763 K3083R possibly damaging Het
Vmn1r74 A T 7: 11,846,961 I63F probably benign Het
Vmn2r38 C T 7: 9,097,638 C43Y possibly damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Vps13d A G 4: 145,057,462 V3914A Het
Vwa5b2 A G 16: 20,604,128 T984A probably benign Het
Zc3h3 C T 15: 75,840,382 V77M probably damaging Het
Zfp397 A T 18: 23,960,358 H300L probably damaging Het
Zfp950 G A 19: 61,119,212 R478C probably benign Het
Other mutations in Cyp4a32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Cyp4a32 APN 4 115610503 missense probably benign
IGL02546:Cyp4a32 APN 4 115611323 missense probably damaging 0.98
IGL02578:Cyp4a32 APN 4 115609742 missense possibly damaging 0.79
IGL02663:Cyp4a32 APN 4 115610590 missense probably damaging 1.00
IGL02832:Cyp4a32 APN 4 115614621 missense probably damaging 0.99
IGL03283:Cyp4a32 APN 4 115611083 missense possibly damaging 0.79
IGL03357:Cyp4a32 APN 4 115611601 missense probably benign 0.00
IGL03406:Cyp4a32 APN 4 115602303 missense probably benign 0.00
R0379:Cyp4a32 UTSW 4 115621474 missense probably damaging 1.00
R1339:Cyp4a32 UTSW 4 115611563 missense probably damaging 0.98
R1435:Cyp4a32 UTSW 4 115606666 missense probably damaging 0.97
R1445:Cyp4a32 UTSW 4 115602950 nonsense probably null
R1520:Cyp4a32 UTSW 4 115614652 missense probably damaging 0.97
R1587:Cyp4a32 UTSW 4 115610534 missense probably benign 0.06
R1719:Cyp4a32 UTSW 4 115611308 missense possibly damaging 0.61
R1932:Cyp4a32 UTSW 4 115611277 missense possibly damaging 0.78
R4184:Cyp4a32 UTSW 4 115621523 missense possibly damaging 0.94
R4580:Cyp4a32 UTSW 4 115602929 splice site silent
R5004:Cyp4a32 UTSW 4 115601041 missense probably damaging 0.98
R6345:Cyp4a32 UTSW 4 115602363 missense possibly damaging 0.81
R7241:Cyp4a32 UTSW 4 115602302 missense probably benign
R7419:Cyp4a32 UTSW 4 115611037 missense probably benign
R7716:Cyp4a32 UTSW 4 115601086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCCTTTCACAAAGAGATGTTTTGC -3'
(R):5'- TGAATGGAGCTTGGGGTAATAC -3'

Sequencing Primer
(F):5'- CACAAAGAGATGTTTTGCAATCTG -3'
(R):5'- AGCTTGGGGTAATACTCTTTATTGAG -3'
Posted On2019-06-26