Incidental Mutation 'R7231:Dennd5b'
ID 562462
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 045342-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R7231 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 148946102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 503 (R503Q)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: R503Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: R503Q

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (78/80)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,244,175 (GRCm39) T2013S probably benign Het
Ablim3 A G 18: 61,938,135 (GRCm39) probably null Het
Acvrl1 T A 15: 101,034,104 (GRCm39) C206* probably null Het
Adamts15 C A 9: 30,817,454 (GRCm39) R541S probably damaging Het
Add3 A G 19: 53,221,577 (GRCm39) I230V probably benign Het
Ankrd27 A G 7: 35,327,871 (GRCm39) D742G possibly damaging Het
Asxl3 A G 18: 22,650,597 (GRCm39) E862G probably damaging Het
Asxl3 A T 18: 22,544,556 (GRCm39) probably null Het
Atp2b2 G A 6: 113,742,693 (GRCm39) T798M possibly damaging Het
Car12 T C 9: 66,659,599 (GRCm39) I208T probably damaging Het
Cgn T A 3: 94,680,502 (GRCm39) Q600L probably damaging Het
Cgnl1 C T 9: 71,539,927 (GRCm39) A1106T probably benign Het
Cmtr2 T C 8: 110,949,178 (GRCm39) V496A probably benign Het
Cplx4 C A 18: 66,090,123 (GRCm39) D99Y probably damaging Het
Cyfip2 T C 11: 46,114,963 (GRCm39) T915A probably benign Het
Cyp4a32 T C 4: 115,466,894 (GRCm39) L193P probably damaging Het
Depdc5 C A 5: 33,059,209 (GRCm39) Q303K possibly damaging Het
Dlx1 T A 2: 71,362,840 (GRCm39) M249K possibly damaging Het
Dnah10 A T 5: 124,890,892 (GRCm39) E3218V probably benign Het
Dnah9 T C 11: 65,856,473 (GRCm39) D2896G probably damaging Het
Dtx4 C A 19: 12,447,022 (GRCm39) G557* probably null Het
Eps8l2 A G 7: 140,940,305 (GRCm39) N512D probably damaging Het
Fam20a T C 11: 109,612,201 (GRCm39) D114G possibly damaging Het
Fbln1 T C 15: 85,090,353 (GRCm39) S7P unknown Het
Fli1 T C 9: 32,335,484 (GRCm39) E316G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Haus8 G A 8: 71,705,781 (GRCm39) T302I probably benign Het
Hmcn1 T C 1: 150,514,627 (GRCm39) I3582V probably benign Het
Hnrnpul1 G A 7: 25,447,842 (GRCm39) Q161* probably null Het
Hsf4 C T 8: 105,998,779 (GRCm39) A223V probably damaging Het
Ighg2c A G 12: 113,251,636 (GRCm39) W164R Het
Isl1 A G 13: 116,439,826 (GRCm39) V174A probably benign Het
Itih4 A T 14: 30,618,571 (GRCm39) I661F probably benign Het
Klhl14 A T 18: 21,785,193 (GRCm39) L78Q probably damaging Het
L3mbtl3 T A 10: 26,215,180 (GRCm39) I177F unknown Het
Lingo3 T A 10: 80,670,938 (GRCm39) T331S possibly damaging Het
Lrrc36 T C 8: 106,187,689 (GRCm39) V535A possibly damaging Het
Mapk8ip2 T G 15: 89,342,279 (GRCm39) S497A probably benign Het
Mbip A G 12: 56,384,547 (GRCm39) probably null Het
Nelfa C T 5: 34,056,169 (GRCm39) G498D probably damaging Het
Nherf2 C T 17: 24,869,078 (GRCm39) R16H probably damaging Het
Nlrc5 T A 8: 95,248,433 (GRCm39) probably null Het
Or2ag2b A T 7: 106,417,650 (GRCm39) Y120F probably damaging Het
Or4f59 A T 2: 111,872,711 (GRCm39) V222D probably damaging Het
Or56a3 T C 7: 104,734,994 (GRCm39) S24P possibly damaging Het
Or7e171-ps1 T A 9: 19,852,855 (GRCm39) T294S unknown Het
Pde2a A G 7: 101,155,160 (GRCm39) Y567C probably damaging Het
Pdia4 A T 6: 47,777,891 (GRCm39) F367Y probably benign Het
Pkdrej C A 15: 85,700,389 (GRCm39) C1849F possibly damaging Het
Plekhj1 T G 10: 80,633,492 (GRCm39) T52P probably damaging Het
Ppp2r5d A T 17: 46,994,986 (GRCm39) Y572N probably benign Het
Prkcq T A 2: 11,295,262 (GRCm39) Y570* probably null Het
Ptpn3 T A 4: 57,245,062 (GRCm39) D226V probably damaging Het
Rab1b A G 19: 5,155,229 (GRCm39) S22P probably damaging Het
Ralgapa1 A G 12: 55,650,976 (GRCm39) S2060P probably damaging Het
Rnf148 G T 6: 23,654,890 (GRCm39) S35R probably benign Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Samd15 T A 12: 87,247,818 (GRCm39) S168T possibly damaging Het
Slc26a4 T A 12: 31,597,945 (GRCm39) N167I probably damaging Het
Slc39a1 C A 3: 90,159,097 (GRCm39) H141Q probably benign Het
Snx21 T C 2: 164,628,121 (GRCm39) S46P probably benign Het
Strip2 A G 6: 29,944,486 (GRCm39) S657G probably damaging Het
Stxbp3 G A 3: 108,708,125 (GRCm39) P392L probably damaging Het
Suclg1 G A 6: 73,240,954 (GRCm39) R161H probably benign Het
Tas1r3 T C 4: 155,947,283 (GRCm39) Y134C probably damaging Het
Tgif1 T A 17: 71,153,168 (GRCm39) Q114L probably damaging Het
Tll2 A G 19: 41,074,673 (GRCm39) F964L probably benign Het
Tmem181a T C 17: 6,348,195 (GRCm39) S247P possibly damaging Het
Trav23 A T 14: 54,215,025 (GRCm39) R79S probably damaging Het
Trf C A 9: 103,102,347 (GRCm39) C177F probably damaging Het
Triml1 T C 8: 43,589,408 (GRCm39) Y260C probably benign Het
Tulp4 T C 17: 6,286,510 (GRCm39) F1513L probably benign Het
Umodl1 G A 17: 31,205,090 (GRCm39) V562I probably damaging Het
Ush2a A G 1: 188,491,960 (GRCm39) K3083R possibly damaging Het
Vmn1r74 A T 7: 11,580,888 (GRCm39) I63F probably benign Het
Vmn2r38 C T 7: 9,100,637 (GRCm39) C43Y possibly damaging Het
Vmn2r50 A T 7: 9,787,010 (GRCm39) N32K probably benign Het
Vps13d A G 4: 144,784,032 (GRCm39) V3914A Het
Vwa5b2 A G 16: 20,422,878 (GRCm39) T984A probably benign Het
Zc3h3 C T 15: 75,712,231 (GRCm39) V77M probably damaging Het
Zfp397 A T 18: 24,093,415 (GRCm39) H300L probably damaging Het
Zfp950 G A 19: 61,107,650 (GRCm39) R478C probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTAAGAGCGGTCAATTTGC -3'
(R):5'- TCAGCGTGTATGAGCTACTG -3'

Sequencing Primer
(F):5'- CTTACTACATAGCAGAGGATGGCC -3'
(R):5'- CGTGTATGAGCTACTGAAGGGC -3'
Posted On 2019-06-26