Incidental Mutation 'R0576:Cxxc1'
ID56248
Institutional Source Beutler Lab
Gene Symbol Cxxc1
Ensembl Gene ENSMUSG00000024560
Gene NameCXXC finger 1 (PHD domain)
Synonyms2410002I16Rik, 5830420C16Rik, PHF18, Cgbp, Cfp1
MMRRC Submission 038766-MU
Accession Numbers

Ncbi RefSeq: NM_028868.3; MGI:1921572

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0576 (G1)
Quality Score199
Status Validated
Chromosome18
Chromosomal Location74216131-74221491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74220185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 497 (I497T)
Ref Sequence ENSEMBL: ENSMUSP00000025444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025444]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025444
AA Change: I497T

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025444
Gene: ENSMUSG00000024560
AA Change: I497T

DomainStartEndE-ValueType
PHD 28 74 1.26e-10 SMART
Pfam:zf-CXXC 164 212 2.4e-19 PFAM
low complexity region 237 253 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
low complexity region 325 364 N/A INTRINSIC
Pfam:zf-CpG_bind_C 404 640 2.1e-108 PFAM
Meta Mutation Damage Score 0.2044 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype Strain: 2654854
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a transcriptional activator that binds specifically to non-methylated CpG motifs through its CXXC domain. The protein is a component of the SETD1 complex, regulates gene expression and is essential for vertebrate development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit peri-implantation lethality and failure to gastrulate. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)
 

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,713,470 F839L probably benign Het
Ccdc77 T A 6: 120,331,848 L335F probably benign Het
Ccr3 T A 9: 124,029,009 F127Y probably damaging Het
Cfap43 T C 19: 47,797,140 N437S probably benign Het
Cfh A G 1: 140,136,815 V365A probably damaging Het
Copg1 T A 6: 87,897,963 V380D probably damaging Het
Disp3 G A 4: 148,241,590 T1237I possibly damaging Het
Dnah7a A T 1: 53,636,087 F360L probably benign Het
Dnhd1 C T 7: 105,714,045 A3938V probably damaging Het
Eif4g1 A G 16: 20,684,068 D1000G probably damaging Het
Emsy A T 7: 98,593,776 V1052D probably damaging Het
Ep400 A G 5: 110,711,093 probably benign Het
Fa2h T C 8: 111,356,147 H146R probably damaging Het
Gad1 G A 2: 70,594,652 C430Y probably benign Het
Gm38394 A G 1: 133,657,838 F587S probably benign Het
Gtse1 T C 15: 85,869,051 S456P probably damaging Het
Gucy2g T C 19: 55,198,770 T1073A probably damaging Het
Hectd2 T G 19: 36,585,497 N3K probably benign Het
Hmcn1 A T 1: 150,650,017 C3318* probably null Het
Lipo2 C T 19: 33,749,424 S71N probably benign Het
Mynn G T 3: 30,607,068 D100Y probably damaging Het
Myo16 G A 8: 10,562,318 probably null Het
Npr2 G T 4: 43,640,947 K384N probably benign Het
Nrde2 A G 12: 100,132,233 V725A possibly damaging Het
Olfr166 A G 16: 19,487,188 M117V probably damaging Het
Olfr748 T A 14: 50,711,204 S291R probably damaging Het
Otud7a C T 7: 63,685,518 P101S possibly damaging Het
Pcdhb7 T A 18: 37,342,357 L182Q probably benign Het
Pdss1 A G 2: 22,915,413 probably null Het
Ppargc1b T A 18: 61,311,441 H233L probably damaging Het
Ppm1b A G 17: 85,013,559 probably null Het
Prdm14 A T 1: 13,125,725 S37R possibly damaging Het
Prss45 A G 9: 110,838,429 T39A probably benign Het
Qars T C 9: 108,514,962 probably benign Het
Rxfp2 T G 5: 150,038,247 H77Q probably benign Het
Scd4 A G 19: 44,341,246 M219V probably benign Het
Sec24b G T 3: 130,041,336 P71Q probably benign Het
Snd1 T G 6: 28,886,577 V861G probably benign Het
Sspo A G 6: 48,464,942 probably null Het
Tas2r129 A G 6: 132,951,534 T145A probably benign Het
Tbc1d31 T A 15: 57,969,724 I953N possibly damaging Het
Tlr4 A G 4: 66,839,495 N175S probably benign Het
Tspyl4 A G 10: 34,298,522 N337D probably damaging Het
Ttn A T 2: 76,812,201 L13330H probably damaging Het
Usp33 T A 3: 152,384,119 Y765* probably null Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Zfhx4 T C 3: 5,402,101 S2465P probably damaging Het
Other mutations in Cxxc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Cxxc1 APN 18 74219914 missense possibly damaging 0.83
IGL02250:Cxxc1 APN 18 74219169 missense probably benign 0.00
IGL02640:Cxxc1 APN 18 74221183 missense probably damaging 1.00
IGL02802:Cxxc1 UTSW 18 74219410 nonsense probably null
P0018:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
R0534:Cxxc1 UTSW 18 74218891 missense probably benign 0.00
R0557:Cxxc1 UTSW 18 74218774 missense possibly damaging 0.92
R0673:Cxxc1 UTSW 18 74218913 missense possibly damaging 0.92
R1539:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.53
R1714:Cxxc1 UTSW 18 74219863 missense probably damaging 1.00
R4763:Cxxc1 UTSW 18 74219413 missense probably damaging 0.98
R5252:Cxxc1 UTSW 18 74219951 missense probably benign 0.30
R5890:Cxxc1 UTSW 18 74221166 missense possibly damaging 0.68
R6908:Cxxc1 UTSW 18 74220559 missense probably damaging 1.00
R7064:Cxxc1 UTSW 18 74220607 critical splice donor site probably null
R7305:Cxxc1 UTSW 18 74219396 missense probably benign 0.02
R7404:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.95
R7790:Cxxc1 UTSW 18 74217784 missense probably damaging 0.99
T0975:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
X0028:Cxxc1 UTSW 18 74218801 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCATCATTCTTCGCGCTAAG -3'
(R):5'- TGTGGGGTACATGGACCCAAAAGAC -3'

Sequencing Primer
(F):5'- TTCGCGCTAAGCAGCAAG -3'
(R):5'- CTGGCTCTCATACTACAGGGATG -3'
Posted On2013-07-11