Incidental Mutation 'R7231:Ppp2r5d'
ID562509
Institutional Source Beutler Lab
Gene Symbol Ppp2r5d
Ensembl Gene ENSMUSG00000059409
Gene Nameprotein phosphatase 2, regulatory subunit B', delta
SynonymsTEG-271, B'delta, Tex271
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7231 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46682991-46705002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46684060 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 572 (Y572N)
Ref Sequence ENSEMBL: ENSMUSP00000002839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002839] [ENSMUST00000002845] [ENSMUST00000071841] [ENSMUST00000165007]
Predicted Effect probably benign
Transcript: ENSMUST00000002839
AA Change: Y572N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002839
Gene: ENSMUSG00000059409
AA Change: Y572N

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
Pfam:B56 95 505 6.2e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002845
SMART Domains Protein: ENSMUSP00000002845
Gene: ENSMUSG00000002768

DomainStartEndE-ValueType
Pfam:MEA1 1 174 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071841
SMART Domains Protein: ENSMUSP00000071743
Gene: ENSMUSG00000063576

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 1.6e-8 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_4 13 65 3.8e-8 PFAM
Pfam:Kelch_6 13 67 9.6e-11 PFAM
Pfam:Kelch_5 73 113 3.1e-8 PFAM
Pfam:Kelch_1 76 117 1.9e-7 PFAM
Pfam:Kelch_6 76 121 1.7e-9 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_4 77 125 4.6e-11 PFAM
Pfam:Kelch_3 86 136 1.3e-12 PFAM
Pfam:Kelch_1 127 172 1.5e-10 PFAM
Pfam:Kelch_6 127 173 2e-10 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.3e-10 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_1 180 233 5.8e-9 PFAM
Pfam:Kelch_3 189 247 7.3e-8 PFAM
Pfam:Kelch_5 235 276 1.2e-11 PFAM
Pfam:Kelch_1 238 284 2.7e-8 PFAM
Pfam:Kelch_6 238 293 2.4e-12 PFAM
Pfam:Kelch_3 248 299 4.2e-10 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165007
SMART Domains Protein: ENSMUSP00000128271
Gene: ENSMUSG00000063576

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 9.9e-10 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_6 13 66 7.5e-11 PFAM
Pfam:Kelch_4 13 71 1.4e-8 PFAM
Pfam:Kelch_5 73 113 3e-8 PFAM
Pfam:Kelch_1 76 118 2.6e-8 PFAM
Pfam:Kelch_6 76 121 1.1e-10 PFAM
Pfam:Kelch_4 76 126 2e-11 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_3 86 136 7.7e-12 PFAM
Pfam:Kelch_1 127 170 1.2e-8 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.7e-7 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_6 179 239 2.5e-9 PFAM
Pfam:Kelch_1 180 232 3.4e-8 PFAM
Pfam:Kelch_3 189 247 5.7e-8 PFAM
Pfam:Kelch_5 235 276 4.3e-10 PFAM
Pfam:Kelch_1 238 285 9.3e-10 PFAM
Pfam:Kelch_4 238 291 9.9e-8 PFAM
Pfam:Kelch_6 238 293 2.5e-12 PFAM
Pfam:Kelch_3 248 299 1.1e-9 PFAM
low complexity region 322 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a delta isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trap allele exhibit lethality, while heterozygous mice display decreased prepulse inhibition. Mice homozygous for a targeted knock-out allele exhibit decreased thermal nociception threshold, impaired coordination, and increasedlatency to removing an adhesive sticker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,294,175 T2013S probably benign Het
Ablim3 A G 18: 61,805,064 probably null Het
Acvrl1 T A 15: 101,136,223 C206* probably null Het
Adamts15 C A 9: 30,906,158 R541S probably damaging Het
Add3 A G 19: 53,233,146 I230V probably benign Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Asxl3 A T 18: 22,411,499 probably null Het
Asxl3 A G 18: 22,517,540 E862G probably damaging Het
Atp2b2 G A 6: 113,765,732 T798M possibly damaging Het
Car12 T C 9: 66,752,317 I208T probably damaging Het
Cgn T A 3: 94,773,192 Q600L probably damaging Het
Cgnl1 C T 9: 71,632,645 A1106T probably benign Het
Cmtr2 T C 8: 110,222,546 V496A probably benign Het
Cplx4 C A 18: 65,957,052 D99Y probably damaging Het
Cyfip2 T C 11: 46,224,136 T915A probably benign Het
Cyp4a32 T C 4: 115,609,697 L193P probably damaging Het
Dennd5b C T 6: 149,044,604 R503Q probably damaging Het
Depdc5 C A 5: 32,901,865 Q303K possibly damaging Het
Dlx1 T A 2: 71,532,496 M249K possibly damaging Het
Dnah10 A T 5: 124,813,828 E3218V probably benign Het
Dnah9 T C 11: 65,965,647 D2896G probably damaging Het
Dtx4 C A 19: 12,469,658 G557* probably null Het
Eps8l2 A G 7: 141,360,392 N512D probably damaging Het
Fam20a T C 11: 109,721,375 D114G possibly damaging Het
Fbln1 T C 15: 85,206,152 S7P unknown Het
Fli1 T C 9: 32,424,188 E316G probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Haus8 G A 8: 71,253,137 T302I probably benign Het
Hmcn1 T C 1: 150,638,876 I3582V probably benign Het
Hnrnpul1 G A 7: 25,748,417 Q161* probably null Het
Hsf4 C T 8: 105,272,147 A223V probably damaging Het
Ighg2c A G 12: 113,288,016 W164R Het
Isl1 A G 13: 116,303,290 V174A probably benign Het
Itih4 A T 14: 30,896,614 I661F probably benign Het
Klhl14 A T 18: 21,652,136 L78Q probably damaging Het
L3mbtl3 T A 10: 26,339,282 I177F unknown Het
Lingo3 T A 10: 80,835,104 T331S possibly damaging Het
Lrrc36 T C 8: 105,461,057 V535A possibly damaging Het
Mapk8ip2 T G 15: 89,458,076 S497A probably benign Het
Mbip A G 12: 56,337,762 probably null Het
Nelfa C T 5: 33,898,825 G498D probably damaging Het
Nlrc5 T A 8: 94,521,805 probably null Het
Olfr1312 A T 2: 112,042,366 V222D probably damaging Het
Olfr679 T C 7: 105,085,787 S24P possibly damaging Het
Olfr701 A T 7: 106,818,443 Y120F probably damaging Het
Olfr863-ps1 T A 9: 19,941,559 T294S unknown Het
Pde2a A G 7: 101,505,953 Y567C probably damaging Het
Pdia4 A T 6: 47,800,957 F367Y probably benign Het
Pkdrej C A 15: 85,816,188 C1849F possibly damaging Het
Plekhj1 T G 10: 80,797,658 T52P probably damaging Het
Prkcq T A 2: 11,290,451 Y570* probably null Het
Ptpn3 T A 4: 57,245,062 D226V probably damaging Het
Rab1b A G 19: 5,105,201 S22P probably damaging Het
Ralgapa1 A G 12: 55,604,191 S2060P probably damaging Het
Rnf148 G T 6: 23,654,891 S35R probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Samd15 T A 12: 87,201,044 S168T possibly damaging Het
Slc26a4 T A 12: 31,547,946 N167I probably damaging Het
Slc39a1 C A 3: 90,251,790 H141Q probably benign Het
Slc9a3r2 C T 17: 24,650,104 R16H probably damaging Het
Snx21 T C 2: 164,786,201 S46P probably benign Het
Strip2 A G 6: 29,944,487 S657G probably damaging Het
Stxbp3 G A 3: 108,800,809 P392L probably damaging Het
Suclg1 G A 6: 73,263,971 R161H probably benign Het
Tas1r3 T C 4: 155,862,826 Y134C probably damaging Het
Tgif1 T A 17: 70,846,173 Q114L probably damaging Het
Tll2 A G 19: 41,086,234 F964L probably benign Het
Tmem181a T C 17: 6,297,920 S247P possibly damaging Het
Trav23 A T 14: 53,977,568 R79S probably damaging Het
Trf C A 9: 103,225,148 C177F probably damaging Het
Triml1 T C 8: 43,136,371 Y260C probably benign Het
Tulp4 T C 17: 6,236,235 F1513L probably benign Het
Umodl1 G A 17: 30,986,116 V562I probably damaging Het
Ush2a A G 1: 188,759,763 K3083R possibly damaging Het
Vmn1r74 A T 7: 11,846,961 I63F probably benign Het
Vmn2r38 C T 7: 9,097,638 C43Y possibly damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Vps13d A G 4: 145,057,462 V3914A Het
Vwa5b2 A G 16: 20,604,128 T984A probably benign Het
Zc3h3 C T 15: 75,840,382 V77M probably damaging Het
Zfp397 A T 18: 23,960,358 H300L probably damaging Het
Zfp950 G A 19: 61,119,212 R478C probably benign Het
Other mutations in Ppp2r5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ppp2r5d APN 17 46685517 critical splice donor site probably null
IGL01570:Ppp2r5d APN 17 46687917 missense possibly damaging 0.64
IGL02504:Ppp2r5d APN 17 46700093 missense probably benign 0.34
R0620:Ppp2r5d UTSW 17 46684018 missense probably benign
R0665:Ppp2r5d UTSW 17 46686404 missense probably damaging 1.00
R1584:Ppp2r5d UTSW 17 46684684 missense probably benign 0.45
R1989:Ppp2r5d UTSW 17 46684099 missense probably benign 0.00
R4261:Ppp2r5d UTSW 17 46687081 nonsense probably null
R5577:Ppp2r5d UTSW 17 46687975 missense probably benign 0.00
R5717:Ppp2r5d UTSW 17 46687894 missense probably damaging 0.99
R6266:Ppp2r5d UTSW 17 46685703 splice site probably null
R6491:Ppp2r5d UTSW 17 46685583 missense probably damaging 1.00
R6792:Ppp2r5d UTSW 17 46704856 missense probably benign
R7060:Ppp2r5d UTSW 17 46687353 missense possibly damaging 0.63
R7100:Ppp2r5d UTSW 17 46685682 missense probably benign 0.03
R7197:Ppp2r5d UTSW 17 46685601 missense probably damaging 0.99
R7237:Ppp2r5d UTSW 17 46686280 missense possibly damaging 0.86
R7420:Ppp2r5d UTSW 17 46687581 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGAGTAGCCAGAGAGGTGC -3'
(R):5'- TTCAGCTCCTGAAGAGGACG -3'

Sequencing Primer
(F):5'- TAGCCAGAGAGGTGCCGTTC -3'
(R):5'- CTCCTGAAGAGGACGGTGGAG -3'
Posted On2019-06-26