Incidental Mutation 'R0576:Scd4'
ID 56251
Institutional Source Beutler Lab
Gene Symbol Scd4
Ensembl Gene ENSMUSG00000050195
Gene Name stearoyl-coenzyme A desaturase 4
Synonyms
MMRRC Submission 038766-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R0576 (G1)
Quality Score 219
Status Validated
Chromosome 19
Chromosomal Location 44321765-44335182 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44329685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 219 (M219V)
Ref Sequence ENSEMBL: ENSMUSP00000059860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058856]
AlphaFold Q6T707
Predicted Effect probably benign
Transcript: ENSMUST00000058856
AA Change: M219V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000059860
Gene: ENSMUSG00000050195
AA Change: M219V

DomainStartEndE-ValueType
transmembrane domain 65 87 N/A INTRINSIC
Pfam:FA_desaturase 91 311 7e-17 PFAM
Meta Mutation Damage Score 0.0675 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc77 T A 6: 120,308,809 (GRCm39) L335F probably benign Het
Ccr3 T A 9: 123,829,046 (GRCm39) F127Y probably damaging Het
Cfap43 T C 19: 47,785,579 (GRCm39) N437S probably benign Het
Cfh A G 1: 140,064,553 (GRCm39) V365A probably damaging Het
Copg1 T A 6: 87,874,945 (GRCm39) V380D probably damaging Het
Cxxc1 T C 18: 74,353,256 (GRCm39) I497T possibly damaging Het
Disp3 G A 4: 148,326,047 (GRCm39) T1237I possibly damaging Het
Dnaaf9 A T 2: 130,555,390 (GRCm39) F839L probably benign Het
Dnah7a A T 1: 53,675,246 (GRCm39) F360L probably benign Het
Dnhd1 C T 7: 105,363,252 (GRCm39) A3938V probably damaging Het
Eif4g1 A G 16: 20,502,818 (GRCm39) D1000G probably damaging Het
Emsy A T 7: 98,242,983 (GRCm39) V1052D probably damaging Het
Ep400 A G 5: 110,858,959 (GRCm39) probably benign Het
Fa2h T C 8: 112,082,779 (GRCm39) H146R probably damaging Het
Gad1 G A 2: 70,424,996 (GRCm39) C430Y probably benign Het
Gtse1 T C 15: 85,753,252 (GRCm39) S456P probably damaging Het
Gucy2g T C 19: 55,187,202 (GRCm39) T1073A probably damaging Het
Hectd2 T G 19: 36,562,897 (GRCm39) N3K probably benign Het
Hmcn1 A T 1: 150,525,768 (GRCm39) C3318* probably null Het
Lipo2 C T 19: 33,726,824 (GRCm39) S71N probably benign Het
Mynn G T 3: 30,661,217 (GRCm39) D100Y probably damaging Het
Myo16 G A 8: 10,612,318 (GRCm39) probably null Het
Npr2 G T 4: 43,640,947 (GRCm39) K384N probably benign Het
Nrde2 A G 12: 100,098,492 (GRCm39) V725A possibly damaging Het
Or11h23 T A 14: 50,948,661 (GRCm39) S291R probably damaging Het
Or2l13 A G 16: 19,305,938 (GRCm39) M117V probably damaging Het
Otud7a C T 7: 63,335,266 (GRCm39) P101S possibly damaging Het
Pcdhb7 T A 18: 37,475,410 (GRCm39) L182Q probably benign Het
Pdss1 A G 2: 22,805,425 (GRCm39) probably null Het
Ppargc1b T A 18: 61,444,512 (GRCm39) H233L probably damaging Het
Ppm1b A G 17: 85,320,987 (GRCm39) probably null Het
Prdm14 A T 1: 13,195,949 (GRCm39) S37R possibly damaging Het
Prss45 A G 9: 110,667,497 (GRCm39) T39A probably benign Het
Qars1 T C 9: 108,392,161 (GRCm39) probably benign Het
Rxfp2 T G 5: 149,961,712 (GRCm39) H77Q probably benign Het
Sec24b G T 3: 129,834,985 (GRCm39) P71Q probably benign Het
Snd1 T G 6: 28,886,576 (GRCm39) V861G probably benign Het
Sspo A G 6: 48,441,876 (GRCm39) probably null Het
Tas2r129 A G 6: 132,928,497 (GRCm39) T145A probably benign Het
Tbc1d31 T A 15: 57,833,120 (GRCm39) I953N possibly damaging Het
Tlr4 A G 4: 66,757,732 (GRCm39) N175S probably benign Het
Tspyl4 A G 10: 34,174,518 (GRCm39) N337D probably damaging Het
Ttn A T 2: 76,642,545 (GRCm39) L13330H probably damaging Het
Usp33 T A 3: 152,089,756 (GRCm39) Y765* probably null Het
Vmn2r59 T A 7: 41,696,529 (GRCm39) Y71F probably benign Het
Zbed6 A G 1: 133,585,576 (GRCm39) F587S probably benign Het
Zfhx4 T C 3: 5,467,161 (GRCm39) S2465P probably damaging Het
Other mutations in Scd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Scd4 APN 19 44,333,186 (GRCm39) missense possibly damaging 0.54
IGL02824:Scd4 APN 19 44,329,698 (GRCm39) missense probably damaging 1.00
crisco UTSW 19 44,327,510 (GRCm39) missense probably benign 0.24
IGL03098:Scd4 UTSW 19 44,321,931 (GRCm39) start codon destroyed possibly damaging 0.92
R0655:Scd4 UTSW 19 44,327,407 (GRCm39) missense possibly damaging 0.52
R1792:Scd4 UTSW 19 44,326,013 (GRCm39) nonsense probably null
R1925:Scd4 UTSW 19 44,329,823 (GRCm39) missense probably damaging 0.99
R1995:Scd4 UTSW 19 44,322,617 (GRCm39) missense possibly damaging 0.93
R5018:Scd4 UTSW 19 44,326,048 (GRCm39) missense probably benign 0.09
R5815:Scd4 UTSW 19 44,326,003 (GRCm39) missense probably damaging 1.00
R6036:Scd4 UTSW 19 44,333,231 (GRCm39) missense probably damaging 0.98
R6036:Scd4 UTSW 19 44,333,231 (GRCm39) missense probably damaging 0.98
R6264:Scd4 UTSW 19 44,327,398 (GRCm39) nonsense probably null
R6946:Scd4 UTSW 19 44,321,953 (GRCm39) missense probably null 0.82
R7661:Scd4 UTSW 19 44,327,510 (GRCm39) missense probably benign 0.24
R7957:Scd4 UTSW 19 44,329,687 (GRCm39) missense probably benign 0.00
R8112:Scd4 UTSW 19 44,325,945 (GRCm39) missense probably benign 0.00
R8226:Scd4 UTSW 19 44,322,572 (GRCm39) missense probably benign 0.00
R9752:Scd4 UTSW 19 44,322,475 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCCAGGCAGCTAAAGTTAGCAG -3'
(R):5'- CCATTGAAACGAAGGGATTCTCCCG -3'

Sequencing Primer
(F):5'- cacatacatacacatagcaaaacac -3'
(R):5'- GGGCACCAATGCCCCTG -3'
Posted On 2013-07-11