Incidental Mutation 'R7232:Angpt4'
ID562532
Institutional Source Beutler Lab
Gene Symbol Angpt4
Ensembl Gene ENSMUSG00000027460
Gene Nameangiopoietin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7232 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location151911210-151945337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151929540 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 259 (S259P)
Ref Sequence ENSEMBL: ENSMUSP00000028955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028955
AA Change: S259P

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028955
Gene: ENSMUSG00000027460
AA Change: S259P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
coiled coil region 181 239 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
FBG 292 507 2.23e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene is a member of the angiopoietin family of secreted growth factors comprising Angiopoietins-1, -2, and -3, all of which bind the TEK Receptor Tyrosine Kinase. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is involved in survival and migration of endothelial cells and regulates vascular remodeling and maintenance of vascular integrity. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is also required for lymphangiogenesis. Family members bind TEK Receptor Tyrosine Kinase as multimeric clusters but their oligomerization properties differ from one another and this is thought to provide a mechanistic basis for their distinct physiologic roles. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,631 S41T possibly damaging Het
4930433I11Rik G A 7: 40,993,179 G91S probably damaging Het
Adam21 T G 12: 81,560,556 N144T probably damaging Het
Adgrg7 T C 16: 56,777,152 probably null Het
Aqr A C 2: 114,105,882 L1320R probably damaging Het
Arhgef10 G A 8: 14,940,323 G266D probably benign Het
Bop1 A G 15: 76,453,346 V693A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc5l A G 17: 45,427,937 probably null Het
Cfap46 C A 7: 139,617,577 R2126L unknown Het
Chek2 T C 5: 110,860,915 V304A probably damaging Het
Cntnap4 T A 8: 112,665,099 probably null Het
Ctps C A 4: 120,548,124 G374C probably damaging Het
Defa27 A T 8: 21,315,609 I22F probably damaging Het
Dnah14 T C 1: 181,757,363 S3220P probably damaging Het
Dopey2 T G 16: 93,760,485 probably null Het
Dpysl5 G A 5: 30,792,298 V471I probably benign Het
Duoxa1 T A 2: 122,305,247 I124F probably damaging Het
Eif4enif1 A G 11: 3,215,678 E85G possibly damaging Het
Eogt T A 6: 97,119,983 I355F probably damaging Het
Epha7 T A 4: 28,951,279 V800E probably damaging Het
Evi5l A G 8: 4,205,906 Q633R possibly damaging Het
Fam170a T C 18: 50,281,661 Y125H probably damaging Het
Fbxo15 T C 18: 84,962,622 Y241H probably damaging Het
Gbe1 T C 16: 70,436,940 I235T possibly damaging Het
Gfra3 C T 18: 34,711,181 R102Q probably damaging Het
Gjd4 C T 18: 9,280,380 G233S probably damaging Het
Gm29106 C T 1: 118,199,561 P328S probably damaging Het
Hgfac G T 5: 35,046,914 R507L probably damaging Het
Jakmip3 A G 7: 139,007,626 K153R probably benign Het
Kcnc1 T A 7: 46,427,959 V395E probably damaging Het
Krt6b T C 15: 101,678,142 D304G probably damaging Het
Ldha T C 7: 46,850,899 Y174H probably benign Het
Lgi4 G A 7: 31,067,351 V268M possibly damaging Het
Lpar3 T G 3: 146,241,306 probably null Het
Lrp3 T C 7: 35,206,052 D103G probably damaging Het
March5 G A 19: 37,217,314 probably null Het
Muc5b A T 7: 141,866,129 H4115L possibly damaging Het
Myh13 G A 11: 67,348,846 D741N probably damaging Het
Naglu A T 11: 101,076,426 I401F probably damaging Het
Ncam2 T A 16: 81,512,871 N416K probably damaging Het
Ncan A G 8: 70,112,088 L292S probably damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Olfr714 T A 7: 107,073,855 I9K probably benign Het
Onecut2 T A 18: 64,341,562 W395R probably damaging Het
Pak6 T A 2: 118,693,522 V386E probably damaging Het
Pias2 A G 18: 77,133,235 S396G probably benign Het
Plxna2 T A 1: 194,712,260 L483H probably damaging Het
Prss36 G T 7: 127,935,591 R484S probably benign Het
Ptpn21 A T 12: 98,688,737 V657E probably benign Het
Rassf2 T C 2: 131,996,412 E318G probably damaging Het
Rp1 A C 1: 4,228,601 S623A unknown Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn11a T A 9: 119,759,916 E1308V probably damaging Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Slit3 A G 11: 35,610,689 T417A possibly damaging Het
Sostdc1 C A 12: 36,317,311 A162E possibly damaging Het
Sox13 A T 1: 133,384,391 probably null Het
Sox8 G T 17: 25,567,540 S396R probably benign Het
Sult2a3 A T 7: 14,082,760 F164L possibly damaging Het
Susd2 T C 10: 75,639,851 Y438C probably damaging Het
Tas2r106 T G 6: 131,678,847 T14P probably damaging Het
Tcf25 T A 8: 123,401,061 probably null Het
Tenm3 G A 8: 48,235,935 R2206W probably damaging Het
Tep1 A G 14: 50,844,332 L471P unknown Het
Ticrr A T 7: 79,693,742 K1118N probably damaging Het
Tlr5 G A 1: 182,973,499 E123K probably benign Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
U2surp A G 9: 95,493,717 V141A probably benign Het
Unc79 T A 12: 103,134,475 S2050T possibly damaging Het
Usp13 A G 3: 32,865,871 D235G probably benign Het
Vcam1 T C 3: 116,125,979 T213A possibly damaging Het
Vmn2r60 T A 7: 42,136,742 I323N possibly damaging Het
Vps13b A G 15: 35,877,557 I2892M probably damaging Het
Wnt5a T A 14: 28,518,372 S160T probably benign Het
Zar1 G A 5: 72,580,951 P36L possibly damaging Het
Zfp773 A T 7: 7,132,985 M204K probably benign Het
Zhx1 T C 15: 58,053,069 T594A probably benign Het
Other mutations in Angpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Angpt4 APN 2 151911471 missense probably damaging 0.99
IGL03107:Angpt4 APN 2 151943422 missense probably benign 0.08
IGL03343:Angpt4 APN 2 151936703 missense probably damaging 1.00
R0034:Angpt4 UTSW 2 151929391 missense probably benign 0.44
R0709:Angpt4 UTSW 2 151934514 missense possibly damaging 0.46
R0764:Angpt4 UTSW 2 151911284 start gained probably benign
R0853:Angpt4 UTSW 2 151938927 missense probably damaging 1.00
R1796:Angpt4 UTSW 2 151938989 missense probably damaging 1.00
R2091:Angpt4 UTSW 2 151936783 splice site probably benign
R2184:Angpt4 UTSW 2 151938954 missense probably damaging 1.00
R2901:Angpt4 UTSW 2 151911339 missense unknown
R3014:Angpt4 UTSW 2 151929597 missense probably benign 0.07
R4192:Angpt4 UTSW 2 151943318 missense probably benign
R4440:Angpt4 UTSW 2 151944646 missense probably damaging 1.00
R5059:Angpt4 UTSW 2 151934440 missense probably damaging 1.00
R5326:Angpt4 UTSW 2 151925544 critical splice donor site probably null
R6345:Angpt4 UTSW 2 151929434 missense probably benign 0.00
R7313:Angpt4 UTSW 2 151925406 missense probably benign
R7456:Angpt4 UTSW 2 151939067 missense probably damaging 1.00
R7598:Angpt4 UTSW 2 151925525 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAATGCTCGGAGTGGAGAC -3'
(R):5'- AGCTGGCCTTTCCCACAATG -3'

Sequencing Primer
(F):5'- AGTGGAGACCATAGGCTCACC -3'
(R):5'- CACAATGGGTCCCTGGAC -3'
Posted On2019-06-26