Incidental Mutation 'R0577:D1Ertd622e'
ID56254
Institutional Source Beutler Lab
Gene Symbol D1Ertd622e
Ensembl Gene ENSMUSG00000044768
Gene NameDNA segment, Chr 1, ERATO Doi 622, expressed
Synonyms
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0577 (G1)
Quality Score170
Status Validated
Chromosome1
Chromosomal Location97606318-97662074 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 97661826 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053033] [ENSMUST00000053033] [ENSMUST00000142234] [ENSMUST00000149927] [ENSMUST00000149927] [ENSMUST00000153115]
Predicted Effect probably null
Transcript: ENSMUST00000053033
SMART Domains Protein: ENSMUSP00000051034
Gene: ENSMUSG00000044768

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053033
SMART Domains Protein: ENSMUSP00000051034
Gene: ENSMUSG00000044768

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142234
SMART Domains Protein: ENSMUSP00000137803
Gene: ENSMUSG00000044768

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 134 1.1e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149927
SMART Domains Protein: ENSMUSP00000121997
Gene: ENSMUSG00000044768

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 8.7e-116 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149927
SMART Domains Protein: ENSMUSP00000121997
Gene: ENSMUSG00000044768

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 8.7e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153115
SMART Domains Protein: ENSMUSP00000138031
Gene: ENSMUSG00000044768

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in D1Ertd622e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:D1Ertd622e APN 1 97646006 missense probably damaging 0.99
IGL02349:D1Ertd622e APN 1 97646052 missense probably damaging 1.00
R1646:D1Ertd622e UTSW 1 97645806 missense probably damaging 0.99
R3611:D1Ertd622e UTSW 1 97646334 missense probably damaging 1.00
R5270:D1Ertd622e UTSW 1 97645995 missense probably damaging 1.00
R5934:D1Ertd622e UTSW 1 97645930 missense possibly damaging 0.69
R6863:D1Ertd622e UTSW 1 97646305 missense probably benign
R7133:D1Ertd622e UTSW 1 97645920 missense probably benign 0.01
R7911:D1Ertd622e UTSW 1 97645890 missense probably damaging 0.98
R7992:D1Ertd622e UTSW 1 97645890 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCATTCGCACCAAGGCTCAG -3'
(R):5'- TCACAGCCATCCCCACAGAGTTTAG -3'

Sequencing Primer
(F):5'- GTGTCACCGAGCCATCAG -3'
(R):5'- ggaggaggcgggACTAC -3'
Posted On2013-07-11