Incidental Mutation 'R7232:Scn11a'
ID 562566
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 045303-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7232 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119588982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 1308 (E1308V)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: E1308V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: E1308V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: E1308V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik G A 7: 40,642,603 (GRCm39) G91S probably damaging Het
Adam21 T G 12: 81,607,330 (GRCm39) N144T probably damaging Het
Adgrg7 T C 16: 56,597,515 (GRCm39) probably null Het
Angpt4 T C 2: 151,771,460 (GRCm39) S259P possibly damaging Het
Aqr A C 2: 113,936,363 (GRCm39) L1320R probably damaging Het
Arhgef10 G A 8: 14,990,323 (GRCm39) G266D probably benign Het
Bop1 A G 15: 76,337,546 (GRCm39) V693A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc5l A G 17: 45,738,863 (GRCm39) probably null Het
Cfap46 C A 7: 139,197,493 (GRCm39) R2126L unknown Het
Chek2 T C 5: 111,008,781 (GRCm39) V304A probably damaging Het
Cntnap4 T A 8: 113,391,731 (GRCm39) probably null Het
Ctps1 C A 4: 120,405,321 (GRCm39) G374C probably damaging Het
Defa27 A T 8: 21,805,625 (GRCm39) I22F probably damaging Het
Dnah14 T C 1: 181,584,928 (GRCm39) S3220P probably damaging Het
Dop1b T G 16: 93,557,373 (GRCm39) probably null Het
Dpysl5 G A 5: 30,949,642 (GRCm39) V471I probably benign Het
Duoxa1 T A 2: 122,135,728 (GRCm39) I124F probably damaging Het
Eif4enif1 A G 11: 3,165,678 (GRCm39) E85G possibly damaging Het
Eogt T A 6: 97,096,944 (GRCm39) I355F probably damaging Het
Epha7 T A 4: 28,951,279 (GRCm39) V800E probably damaging Het
Evi5l A G 8: 4,255,906 (GRCm39) Q633R possibly damaging Het
Fam170a T C 18: 50,414,728 (GRCm39) Y125H probably damaging Het
Fbxo15 T C 18: 84,980,747 (GRCm39) Y241H probably damaging Het
Gbe1 T C 16: 70,233,828 (GRCm39) I235T possibly damaging Het
Gfra3 C T 18: 34,844,234 (GRCm39) R102Q probably damaging Het
Gjd4 C T 18: 9,280,380 (GRCm39) G233S probably damaging Het
Gm29106 C T 1: 118,127,291 (GRCm39) P328S probably damaging Het
Hgfac G T 5: 35,204,258 (GRCm39) R507L probably damaging Het
Jakmip3 A G 7: 138,609,355 (GRCm39) K153R probably benign Het
Kcnc1 T A 7: 46,077,383 (GRCm39) V395E probably damaging Het
Krt6b T C 15: 101,586,577 (GRCm39) D304G probably damaging Het
Ldha T C 7: 46,500,323 (GRCm39) Y174H probably benign Het
Lgi4 G A 7: 30,766,776 (GRCm39) V268M possibly damaging Het
Lpar3 T G 3: 145,947,061 (GRCm39) probably null Het
Lrp3 T C 7: 34,905,477 (GRCm39) D103G probably damaging Het
Marchf5 G A 19: 37,194,713 (GRCm39) probably null Het
Muc5b A T 7: 141,419,866 (GRCm39) H4115L possibly damaging Het
Myh13 G A 11: 67,239,672 (GRCm39) D741N probably damaging Het
Naglu A T 11: 100,967,252 (GRCm39) I401F probably damaging Het
Ncam2 T A 16: 81,309,759 (GRCm39) N416K probably damaging Het
Ncan A G 8: 70,564,738 (GRCm39) L292S probably damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nlrp4c T A 7: 6,068,708 (GRCm39) L203* probably null Het
Nscme3l A T 19: 5,553,659 (GRCm39) S41T possibly damaging Het
Onecut2 T A 18: 64,474,633 (GRCm39) W395R probably damaging Het
Or10a2 T A 7: 106,673,062 (GRCm39) I9K probably benign Het
Pak6 T A 2: 118,524,003 (GRCm39) V386E probably damaging Het
Pias2 A G 18: 77,220,931 (GRCm39) S396G probably benign Het
Plxna2 T A 1: 194,394,568 (GRCm39) L483H probably damaging Het
Prss36 G T 7: 127,534,763 (GRCm39) R484S probably benign Het
Ptpn21 A T 12: 98,654,996 (GRCm39) V657E probably benign Het
Rassf2 T C 2: 131,838,332 (GRCm39) E318G probably damaging Het
Rp1 A C 1: 4,298,824 (GRCm39) S623A unknown Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Serpina3c A T 12: 104,115,771 (GRCm39) S258T possibly damaging Het
Slit3 A G 11: 35,501,516 (GRCm39) T417A possibly damaging Het
Sostdc1 C A 12: 36,367,310 (GRCm39) A162E possibly damaging Het
Sox13 A T 1: 133,312,129 (GRCm39) probably null Het
Sox8 G T 17: 25,786,514 (GRCm39) S396R probably benign Het
Sult2a3 A T 7: 13,816,685 (GRCm39) F164L possibly damaging Het
Susd2 T C 10: 75,475,685 (GRCm39) Y438C probably damaging Het
Tas2r106 T G 6: 131,655,810 (GRCm39) T14P probably damaging Het
Tcf25 T A 8: 124,127,800 (GRCm39) probably null Het
Tenm3 G A 8: 48,688,970 (GRCm39) R2206W probably damaging Het
Tep1 A G 14: 51,081,789 (GRCm39) L471P unknown Het
Ticrr A T 7: 79,343,490 (GRCm39) K1118N probably damaging Het
Tlr5 G A 1: 182,801,064 (GRCm39) E123K probably benign Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,746,150 (GRCm39) probably benign Het
U2surp A G 9: 95,375,770 (GRCm39) V141A probably benign Het
Unc79 T A 12: 103,100,734 (GRCm39) S2050T possibly damaging Het
Usp13 A G 3: 32,920,020 (GRCm39) D235G probably benign Het
Vcam1 T C 3: 115,919,628 (GRCm39) T213A possibly damaging Het
Vmn2r60 T A 7: 41,786,166 (GRCm39) I323N possibly damaging Het
Vps13b A G 15: 35,877,703 (GRCm39) I2892M probably damaging Het
Wnt5a T A 14: 28,240,329 (GRCm39) S160T probably benign Het
Zar1 G A 5: 72,738,294 (GRCm39) P36L possibly damaging Het
Zfp773 A T 7: 7,135,984 (GRCm39) M204K probably benign Het
Zhx1 T C 15: 57,916,465 (GRCm39) T594A probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTAAGAACTTGGGTGCATCTTG -3'
(R):5'- GAGTCCAGATTCTTTCAAGTTCC -3'

Sequencing Primer
(F):5'- TCACGAATGACTGCTCTGAG -3'
(R):5'- TCAAGTTCCTTTGGAAGAGGAAC -3'
Posted On 2019-06-26