Incidental Mutation 'R7232:Wnt5a'
ID562578
Institutional Source Beutler Lab
Gene Symbol Wnt5a
Ensembl Gene ENSMUSG00000021994
Gene Namewingless-type MMTV integration site family, member 5A
Synonyms8030457G12Rik, Wnt-5a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7232 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location28504750-28527448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28518372 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 160 (S160T)
Ref Sequence ENSEMBL: ENSMUSP00000064878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]
Predicted Effect probably benign
Transcript: ENSMUST00000063465
AA Change: S160T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: S160T

DomainStartEndE-ValueType
Blast:WNT1 1 46 7e-6 BLAST
WNT1 71 380 6.71e-222 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112272
AA Change: S140T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: S140T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WNT1 51 360 6.71e-222 SMART
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,631 S41T possibly damaging Het
4930433I11Rik G A 7: 40,993,179 G91S probably damaging Het
Adam21 T G 12: 81,560,556 N144T probably damaging Het
Adgrg7 T C 16: 56,777,152 probably null Het
Angpt4 T C 2: 151,929,540 S259P possibly damaging Het
Aqr A C 2: 114,105,882 L1320R probably damaging Het
Arhgef10 G A 8: 14,940,323 G266D probably benign Het
Bop1 A G 15: 76,453,346 V693A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc5l A G 17: 45,427,937 probably null Het
Cfap46 C A 7: 139,617,577 R2126L unknown Het
Chek2 T C 5: 110,860,915 V304A probably damaging Het
Cntnap4 T A 8: 112,665,099 probably null Het
Ctps C A 4: 120,548,124 G374C probably damaging Het
Defa27 A T 8: 21,315,609 I22F probably damaging Het
Dnah14 T C 1: 181,757,363 S3220P probably damaging Het
Dopey2 T G 16: 93,760,485 probably null Het
Dpysl5 G A 5: 30,792,298 V471I probably benign Het
Duoxa1 T A 2: 122,305,247 I124F probably damaging Het
Eif4enif1 A G 11: 3,215,678 E85G possibly damaging Het
Eogt T A 6: 97,119,983 I355F probably damaging Het
Epha7 T A 4: 28,951,279 V800E probably damaging Het
Evi5l A G 8: 4,205,906 Q633R possibly damaging Het
Fam170a T C 18: 50,281,661 Y125H probably damaging Het
Fbxo15 T C 18: 84,962,622 Y241H probably damaging Het
Gbe1 T C 16: 70,436,940 I235T possibly damaging Het
Gfra3 C T 18: 34,711,181 R102Q probably damaging Het
Gjd4 C T 18: 9,280,380 G233S probably damaging Het
Gm29106 C T 1: 118,199,561 P328S probably damaging Het
Hgfac G T 5: 35,046,914 R507L probably damaging Het
Jakmip3 A G 7: 139,007,626 K153R probably benign Het
Kcnc1 T A 7: 46,427,959 V395E probably damaging Het
Krt6b T C 15: 101,678,142 D304G probably damaging Het
Ldha T C 7: 46,850,899 Y174H probably benign Het
Lgi4 G A 7: 31,067,351 V268M possibly damaging Het
Lpar3 T G 3: 146,241,306 probably null Het
Lrp3 T C 7: 35,206,052 D103G probably damaging Het
March5 G A 19: 37,217,314 probably null Het
Muc5b A T 7: 141,866,129 H4115L possibly damaging Het
Myh13 G A 11: 67,348,846 D741N probably damaging Het
Naglu A T 11: 101,076,426 I401F probably damaging Het
Ncam2 T A 16: 81,512,871 N416K probably damaging Het
Ncan A G 8: 70,112,088 L292S probably damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Olfr714 T A 7: 107,073,855 I9K probably benign Het
Onecut2 T A 18: 64,341,562 W395R probably damaging Het
Pak6 T A 2: 118,693,522 V386E probably damaging Het
Pias2 A G 18: 77,133,235 S396G probably benign Het
Plxna2 T A 1: 194,712,260 L483H probably damaging Het
Prss36 G T 7: 127,935,591 R484S probably benign Het
Ptpn21 A T 12: 98,688,737 V657E probably benign Het
Rassf2 T C 2: 131,996,412 E318G probably damaging Het
Rp1 A C 1: 4,228,601 S623A unknown Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn11a T A 9: 119,759,916 E1308V probably damaging Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Slit3 A G 11: 35,610,689 T417A possibly damaging Het
Sostdc1 C A 12: 36,317,311 A162E possibly damaging Het
Sox13 A T 1: 133,384,391 probably null Het
Sox8 G T 17: 25,567,540 S396R probably benign Het
Sult2a3 A T 7: 14,082,760 F164L possibly damaging Het
Susd2 T C 10: 75,639,851 Y438C probably damaging Het
Tas2r106 T G 6: 131,678,847 T14P probably damaging Het
Tcf25 T A 8: 123,401,061 probably null Het
Tenm3 G A 8: 48,235,935 R2206W probably damaging Het
Tep1 A G 14: 50,844,332 L471P unknown Het
Ticrr A T 7: 79,693,742 K1118N probably damaging Het
Tlr5 G A 1: 182,973,499 E123K probably benign Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
U2surp A G 9: 95,493,717 V141A probably benign Het
Unc79 T A 12: 103,134,475 S2050T possibly damaging Het
Usp13 A G 3: 32,865,871 D235G probably benign Het
Vcam1 T C 3: 116,125,979 T213A possibly damaging Het
Vmn2r60 T A 7: 42,136,742 I323N possibly damaging Het
Vps13b A G 15: 35,877,557 I2892M probably damaging Het
Zar1 G A 5: 72,580,951 P36L possibly damaging Het
Zfp773 A T 7: 7,132,985 M204K probably benign Het
Zhx1 T C 15: 58,053,069 T594A probably benign Het
Other mutations in Wnt5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Wnt5a APN 14 28522909 missense probably damaging 1.00
IGL01945:Wnt5a APN 14 28518562 missense probably damaging 1.00
IGL02117:Wnt5a APN 14 28506120 splice site probably benign
IGL02995:Wnt5a APN 14 28522914 missense probably benign 0.02
IGL03123:Wnt5a APN 14 28522925 missense probably damaging 1.00
Thrush UTSW 14 28518463 missense possibly damaging 0.78
R0254:Wnt5a UTSW 14 28522854 missense probably damaging 1.00
R0277:Wnt5a UTSW 14 28513268 missense possibly damaging 0.74
R0365:Wnt5a UTSW 14 28518504 nonsense probably null
R1472:Wnt5a UTSW 14 28518504 nonsense probably null
R1661:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1662:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1762:Wnt5a UTSW 14 28522891 missense probably damaging 1.00
R1791:Wnt5a UTSW 14 28511878 start codon destroyed probably null 0.00
R1933:Wnt5a UTSW 14 28511845 missense probably benign 0.00
R2147:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R2149:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R3078:Wnt5a UTSW 14 28513183 nonsense probably null
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R4237:Wnt5a UTSW 14 28522866 missense probably damaging 1.00
R5396:Wnt5a UTSW 14 28522770 missense probably damaging 1.00
R6329:Wnt5a UTSW 14 28518492 nonsense probably null
R6698:Wnt5a UTSW 14 28518463 missense possibly damaging 0.78
R6974:Wnt5a UTSW 14 28522570 missense possibly damaging 0.89
R7114:Wnt5a UTSW 14 28522756 missense probably damaging 1.00
R7457:Wnt5a UTSW 14 28518279 splice site probably null
R7666:Wnt5a UTSW 14 28518372 missense possibly damaging 0.88
R8273:Wnt5a UTSW 14 28522605 missense probably damaging 1.00
T0722:Wnt5a UTSW 14 28511925 missense probably benign 0.01
Z1088:Wnt5a UTSW 14 28522728 missense probably damaging 0.99
Z1176:Wnt5a UTSW 14 28511907 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATGATCTATGTATGTTGGGGCTC -3'
(R):5'- AAGTTCATGAGGATGCGTGC -3'

Sequencing Primer
(F):5'- ACAGGCCAGTGCGTTAGG -3'
(R):5'- GTGCGCTCTCATAGGAACCCTTAG -3'
Posted On2019-06-26