Incidental Mutation 'R0577:Ddi2'
ID56258
Institutional Source Beutler Lab
Gene Symbol Ddi2
Ensembl Gene ENSMUSG00000078515
Gene NameDNA-damage inducible protein 2
Synonyms
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R0577 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141677549-141723419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141684507 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 365 (C365S)
Ref Sequence ENSEMBL: ENSMUSP00000136018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102484] [ENSMUST00000105782] [ENSMUST00000177592]
Predicted Effect probably benign
Transcript: ENSMUST00000102484
SMART Domains Protein: ENSMUSP00000099542
Gene: ENSMUSG00000078515

DomainStartEndE-ValueType
Pfam:ubiquitin 10 79 3.1e-9 PFAM
low complexity region 177 189 N/A INTRINSIC
Pfam:Asp_protease 212 335 9.2e-65 PFAM
Pfam:RVP_2 219 348 3.7e-8 PFAM
Pfam:RVP 236 335 3.5e-8 PFAM
Pfam:Asp_protease_2 238 326 2.5e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105782
AA Change: C365S

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101408
Gene: ENSMUSG00000040715
AA Change: C365S

DomainStartEndE-ValueType
low complexity region 315 320 N/A INTRINSIC
UBA 538 575 8.12e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177592
AA Change: C365S

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136018
Gene: ENSMUSG00000078515
AA Change: C365S

DomainStartEndE-ValueType
low complexity region 315 320 N/A INTRINSIC
UBA 538 575 8.12e-6 SMART
Meta Mutation Damage Score 0.2608 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Ddi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ddi2 APN 4 141695398 splice site probably benign
IGL02012:Ddi2 APN 4 141708218 critical splice donor site probably null
IGL02281:Ddi2 APN 4 141692419 missense probably benign 0.18
IGL02395:Ddi2 APN 4 141695414 missense possibly damaging 0.86
IGL03103:Ddi2 APN 4 141703168 missense probably damaging 1.00
IGL03220:Ddi2 APN 4 141708456 missense probably benign
R0350:Ddi2 UTSW 4 141685523 missense probably benign 0.30
R0467:Ddi2 UTSW 4 141685184 missense probably benign 0.02
R1706:Ddi2 UTSW 4 141683997 missense probably benign 0.00
R1801:Ddi2 UTSW 4 141683972 missense probably damaging 0.96
R1839:Ddi2 UTSW 4 141713526 missense probably benign 0.08
R1878:Ddi2 UTSW 4 141684149 missense probably benign 0.08
R2113:Ddi2 UTSW 4 141703280 intron probably null
R3906:Ddi2 UTSW 4 141684281 missense probably benign 0.05
R3907:Ddi2 UTSW 4 141684281 missense probably benign 0.05
R3908:Ddi2 UTSW 4 141684281 missense probably benign 0.05
R4911:Ddi2 UTSW 4 141684402 missense probably benign 0.28
R5296:Ddi2 UTSW 4 141684765 missense probably benign 0.01
R5383:Ddi2 UTSW 4 141684852 missense probably damaging 1.00
R5768:Ddi2 UTSW 4 141685590 missense probably damaging 1.00
R5874:Ddi2 UTSW 4 141695469 missense probably damaging 0.97
R6359:Ddi2 UTSW 4 141684588 missense probably damaging 0.99
R6603:Ddi2 UTSW 4 141683870 missense probably damaging 1.00
R6991:Ddi2 UTSW 4 141685250 missense probably benign 0.22
R7108:Ddi2 UTSW 4 141705937 missense probably benign
R7838:Ddi2 UTSW 4 141685250 missense probably benign 0.22
R7921:Ddi2 UTSW 4 141685250 missense probably benign 0.22
T0722:Ddi2 UTSW 4 141713473 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTGGATGCTTCATCTTCTACCGCAG -3'
(R):5'- CCTAGTGTAGCACATCTCGCTTCAG -3'

Sequencing Primer
(F):5'- TTCTACCGCAGCACAAGGG -3'
(R):5'- GAGCCTGTGGAACATTCCATC -3'
Posted On2013-07-11