Incidental Mutation 'R7232:Dopey2'
ID562586
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7232 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 93760485 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000045004] [ENSMUST00000227156] [ENSMUST00000227156]
Predicted Effect probably null
Transcript: ENSMUST00000045004
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000045004
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226215
Predicted Effect probably benign
Transcript: ENSMUST00000226836
Predicted Effect probably null
Transcript: ENSMUST00000227156
Predicted Effect probably null
Transcript: ENSMUST00000227156
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,631 S41T possibly damaging Het
4930433I11Rik G A 7: 40,993,179 G91S probably damaging Het
Adam21 T G 12: 81,560,556 N144T probably damaging Het
Adgrg7 T C 16: 56,777,152 probably null Het
Angpt4 T C 2: 151,929,540 S259P possibly damaging Het
Aqr A C 2: 114,105,882 L1320R probably damaging Het
Arhgef10 G A 8: 14,940,323 G266D probably benign Het
Bop1 A G 15: 76,453,346 V693A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc5l A G 17: 45,427,937 probably null Het
Cfap46 C A 7: 139,617,577 R2126L unknown Het
Chek2 T C 5: 110,860,915 V304A probably damaging Het
Cntnap4 T A 8: 112,665,099 probably null Het
Ctps C A 4: 120,548,124 G374C probably damaging Het
Defa27 A T 8: 21,315,609 I22F probably damaging Het
Dnah14 T C 1: 181,757,363 S3220P probably damaging Het
Dpysl5 G A 5: 30,792,298 V471I probably benign Het
Duoxa1 T A 2: 122,305,247 I124F probably damaging Het
Eif4enif1 A G 11: 3,215,678 E85G possibly damaging Het
Eogt T A 6: 97,119,983 I355F probably damaging Het
Epha7 T A 4: 28,951,279 V800E probably damaging Het
Evi5l A G 8: 4,205,906 Q633R possibly damaging Het
Fam170a T C 18: 50,281,661 Y125H probably damaging Het
Fbxo15 T C 18: 84,962,622 Y241H probably damaging Het
Gbe1 T C 16: 70,436,940 I235T possibly damaging Het
Gfra3 C T 18: 34,711,181 R102Q probably damaging Het
Gjd4 C T 18: 9,280,380 G233S probably damaging Het
Gm29106 C T 1: 118,199,561 P328S probably damaging Het
Hgfac G T 5: 35,046,914 R507L probably damaging Het
Jakmip3 A G 7: 139,007,626 K153R probably benign Het
Kcnc1 T A 7: 46,427,959 V395E probably damaging Het
Krt6b T C 15: 101,678,142 D304G probably damaging Het
Ldha T C 7: 46,850,899 Y174H probably benign Het
Lgi4 G A 7: 31,067,351 V268M possibly damaging Het
Lpar3 T G 3: 146,241,306 probably null Het
Lrp3 T C 7: 35,206,052 D103G probably damaging Het
March5 G A 19: 37,217,314 probably null Het
Muc5b A T 7: 141,866,129 H4115L possibly damaging Het
Myh13 G A 11: 67,348,846 D741N probably damaging Het
Naglu A T 11: 101,076,426 I401F probably damaging Het
Ncam2 T A 16: 81,512,871 N416K probably damaging Het
Ncan A G 8: 70,112,088 L292S probably damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Olfr714 T A 7: 107,073,855 I9K probably benign Het
Onecut2 T A 18: 64,341,562 W395R probably damaging Het
Pak6 T A 2: 118,693,522 V386E probably damaging Het
Pias2 A G 18: 77,133,235 S396G probably benign Het
Plxna2 T A 1: 194,712,260 L483H probably damaging Het
Prss36 G T 7: 127,935,591 R484S probably benign Het
Ptpn21 A T 12: 98,688,737 V657E probably benign Het
Rassf2 T C 2: 131,996,412 E318G probably damaging Het
Rp1 A C 1: 4,228,601 S623A unknown Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn11a T A 9: 119,759,916 E1308V probably damaging Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Slit3 A G 11: 35,610,689 T417A possibly damaging Het
Sostdc1 C A 12: 36,317,311 A162E possibly damaging Het
Sox13 A T 1: 133,384,391 probably null Het
Sox8 G T 17: 25,567,540 S396R probably benign Het
Sult2a3 A T 7: 14,082,760 F164L possibly damaging Het
Susd2 T C 10: 75,639,851 Y438C probably damaging Het
Tas2r106 T G 6: 131,678,847 T14P probably damaging Het
Tcf25 T A 8: 123,401,061 probably null Het
Tenm3 G A 8: 48,235,935 R2206W probably damaging Het
Tep1 A G 14: 50,844,332 L471P unknown Het
Ticrr A T 7: 79,693,742 K1118N probably damaging Het
Tlr5 G A 1: 182,973,499 E123K probably benign Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
U2surp A G 9: 95,493,717 V141A probably benign Het
Unc79 T A 12: 103,134,475 S2050T possibly damaging Het
Usp13 A G 3: 32,865,871 D235G probably benign Het
Vcam1 T C 3: 116,125,979 T213A possibly damaging Het
Vmn2r60 T A 7: 42,136,742 I323N possibly damaging Het
Vps13b A G 15: 35,877,557 I2892M probably damaging Het
Wnt5a T A 14: 28,518,372 S160T probably benign Het
Zar1 G A 5: 72,580,951 P36L possibly damaging Het
Zfp773 A T 7: 7,132,985 M204K probably benign Het
Zhx1 T C 15: 58,053,069 T594A probably benign Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7700:Dopey2 UTSW 16 93798761 intron probably null
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7922:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7945:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7977:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8061:Dopey2 UTSW 16 93749996 missense probably damaging 1.00
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACTTCTGTGTTCCAGGAAC -3'
(R):5'- GCTGCTGCAGTCATTAGCATG -3'

Sequencing Primer
(F):5'- GTTCCAGGAACTCTACTCTGAGG -3'
(R):5'- GCAGTCATTAGCATGTGTAGCCAC -3'
Posted On2019-06-26