Incidental Mutation 'R7232:1700020D05Rik'
ID 562596
Institutional Source Beutler Lab
Gene Symbol 1700020D05Rik
Ensembl Gene ENSMUSG00000100937
Gene Name RIKEN cDNA 1700020D05 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7232 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 5502767-5503787 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5503631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 41 (S41T)
Ref Sequence ENSEMBL: ENSMUSP00000140922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070172] [ENSMUST00000189704]
AlphaFold Q99PB1
Predicted Effect probably benign
Transcript: ENSMUST00000070172
SMART Domains Protein: ENSMUSP00000070915
Gene: ENSMUSG00000056185

DomainStartEndE-ValueType
Pfam:PX 24 165 1.4e-19 PFAM
Pfam:Vps5 183 394 9.9e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189704
AA Change: S41T

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140922
Gene: ENSMUSG00000100937
AA Change: S41T

DomainStartEndE-ValueType
Pfam:MAGE 82 253 2.2e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik G A 7: 40,993,179 G91S probably damaging Het
Adam21 T G 12: 81,560,556 N144T probably damaging Het
Adgrg7 T C 16: 56,777,152 probably null Het
Angpt4 T C 2: 151,929,540 S259P possibly damaging Het
Aqr A C 2: 114,105,882 L1320R probably damaging Het
Arhgef10 G A 8: 14,940,323 G266D probably benign Het
Bop1 A G 15: 76,453,346 V693A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc5l A G 17: 45,427,937 probably null Het
Cfap46 C A 7: 139,617,577 R2126L unknown Het
Chek2 T C 5: 110,860,915 V304A probably damaging Het
Cntnap4 T A 8: 112,665,099 probably null Het
Ctps C A 4: 120,548,124 G374C probably damaging Het
Defa27 A T 8: 21,315,609 I22F probably damaging Het
Dnah14 T C 1: 181,757,363 S3220P probably damaging Het
Dopey2 T G 16: 93,760,485 probably null Het
Dpysl5 G A 5: 30,792,298 V471I probably benign Het
Duoxa1 T A 2: 122,305,247 I124F probably damaging Het
Eif4enif1 A G 11: 3,215,678 E85G possibly damaging Het
Eogt T A 6: 97,119,983 I355F probably damaging Het
Epha7 T A 4: 28,951,279 V800E probably damaging Het
Evi5l A G 8: 4,205,906 Q633R possibly damaging Het
Fam170a T C 18: 50,281,661 Y125H probably damaging Het
Fbxo15 T C 18: 84,962,622 Y241H probably damaging Het
Gbe1 T C 16: 70,436,940 I235T possibly damaging Het
Gfra3 C T 18: 34,711,181 R102Q probably damaging Het
Gjd4 C T 18: 9,280,380 G233S probably damaging Het
Gm29106 C T 1: 118,199,561 P328S probably damaging Het
Hgfac G T 5: 35,046,914 R507L probably damaging Het
Jakmip3 A G 7: 139,007,626 K153R probably benign Het
Kcnc1 T A 7: 46,427,959 V395E probably damaging Het
Krt6b T C 15: 101,678,142 D304G probably damaging Het
Ldha T C 7: 46,850,899 Y174H probably benign Het
Lgi4 G A 7: 31,067,351 V268M possibly damaging Het
Lpar3 T G 3: 146,241,306 probably null Het
Lrp3 T C 7: 35,206,052 D103G probably damaging Het
March5 G A 19: 37,217,314 probably null Het
Muc5b A T 7: 141,866,129 H4115L possibly damaging Het
Myh13 G A 11: 67,348,846 D741N probably damaging Het
Naglu A T 11: 101,076,426 I401F probably damaging Het
Ncam2 T A 16: 81,512,871 N416K probably damaging Het
Ncan A G 8: 70,112,088 L292S probably damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Olfr714 T A 7: 107,073,855 I9K probably benign Het
Onecut2 T A 18: 64,341,562 W395R probably damaging Het
Pak6 T A 2: 118,693,522 V386E probably damaging Het
Pias2 A G 18: 77,133,235 S396G probably benign Het
Plxna2 T A 1: 194,712,260 L483H probably damaging Het
Prss36 G T 7: 127,935,591 R484S probably benign Het
Ptpn21 A T 12: 98,688,737 V657E probably benign Het
Rassf2 T C 2: 131,996,412 E318G probably damaging Het
Rp1 A C 1: 4,228,601 S623A unknown Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn11a T A 9: 119,759,916 E1308V probably damaging Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Slit3 A G 11: 35,610,689 T417A possibly damaging Het
Sostdc1 C A 12: 36,317,311 A162E possibly damaging Het
Sox13 A T 1: 133,384,391 probably null Het
Sox8 G T 17: 25,567,540 S396R probably benign Het
Sult2a3 A T 7: 14,082,760 F164L possibly damaging Het
Susd2 T C 10: 75,639,851 Y438C probably damaging Het
Tas2r106 T G 6: 131,678,847 T14P probably damaging Het
Tcf25 T A 8: 123,401,061 probably null Het
Tenm3 G A 8: 48,235,935 R2206W probably damaging Het
Tep1 A G 14: 50,844,332 L471P unknown Het
Ticrr A T 7: 79,693,742 K1118N probably damaging Het
Tlr5 G A 1: 182,973,499 E123K probably benign Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
U2surp A G 9: 95,493,717 V141A probably benign Het
Unc79 T A 12: 103,134,475 S2050T possibly damaging Het
Usp13 A G 3: 32,865,871 D235G probably benign Het
Vcam1 T C 3: 116,125,979 T213A possibly damaging Het
Vmn2r60 T A 7: 42,136,742 I323N possibly damaging Het
Vps13b A G 15: 35,877,557 I2892M probably damaging Het
Wnt5a T A 14: 28,518,372 S160T probably benign Het
Zar1 G A 5: 72,580,951 P36L possibly damaging Het
Zfp773 A T 7: 7,132,985 M204K probably benign Het
Zhx1 T C 15: 58,053,069 T594A probably benign Het
Other mutations in 1700020D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:1700020D05Rik APN 19 5503181 missense possibly damaging 0.46
IGL03285:1700020D05Rik APN 19 5503177 missense probably damaging 1.00
R4445:1700020D05Rik UTSW 19 5502994 missense probably damaging 1.00
R4804:1700020D05Rik UTSW 19 5503000 missense possibly damaging 0.82
R5449:1700020D05Rik UTSW 19 5503264 missense probably benign 0.44
R5542:1700020D05Rik UTSW 19 5503435 missense probably damaging 0.99
R6435:1700020D05Rik UTSW 19 5503418 missense probably benign 0.06
R6476:1700020D05Rik UTSW 19 5503225 missense probably damaging 1.00
R6764:1700020D05Rik UTSW 19 5502872 missense probably damaging 1.00
R7102:1700020D05Rik UTSW 19 5503595 missense probably benign 0.00
R7541:1700020D05Rik UTSW 19 5503411 missense probably benign 0.40
R7640:1700020D05Rik UTSW 19 5503007 missense probably damaging 1.00
R9459:1700020D05Rik UTSW 19 5503729 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGACTGCTTGATGGGAATC -3'
(R):5'- CTAGGAAGCACGGTTTGTCC -3'

Sequencing Primer
(F):5'- GGAATCTTCCTCTGGTCCTTAATCAG -3'
(R):5'- ACGGTTTGTCCCCACGC -3'
Posted On 2019-06-26