Incidental Mutation 'R0577:Thsd7a'
ID 56260
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Name thrombospondin, type I, domain containing 7A
Synonyms LOC330267
MMRRC Submission 038767-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0577 (G1)
Quality Score 222
Status Validated
Chromosome 6
Chromosomal Location 12311610-12749410 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12321048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1543 (T1543A)
Ref Sequence ENSEMBL: ENSMUSP00000131662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046121
AA Change: T1543A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: T1543A

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.2e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119581
AA Change: T1543A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: T1543A

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122369
SMART Domains Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 43 100 6.24e-6 SMART
TSP1 178 228 7.31e-2 SMART
Blast:TSP1 232 302 4e-26 BLAST
TSP1 307 362 9.09e-8 SMART
TSP1 365 430 5.82e-1 SMART
TSP1 435 487 4.24e-2 SMART
TSP1 490 551 1e0 SMART
TSP1 556 608 3.55e-10 SMART
TSP1 609 679 7.5e-2 SMART
TSP1 684 742 1.55e-1 SMART
transmembrane domain 874 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137836
Predicted Effect possibly damaging
Transcript: ENSMUST00000172356
AA Change: T1543A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: T1543A

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
G1patch:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0142:Thsd7a UTSW 6 12418335 missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12379605 missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2138:Thsd7a UTSW 6 12471073 nonsense probably null
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12327602 missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6314:Thsd7a UTSW 6 12554997 missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12379430 missense
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
R7666:Thsd7a UTSW 6 12379438 missense
R7869:Thsd7a UTSW 6 12471124 nonsense probably null
R8032:Thsd7a UTSW 6 12555288 missense
R8165:Thsd7a UTSW 6 12468963 missense
R8167:Thsd7a UTSW 6 12317401 nonsense probably null
R8245:Thsd7a UTSW 6 12379593 missense
R8310:Thsd7a UTSW 6 12396613 missense
R8312:Thsd7a UTSW 6 12471182 missense
R8331:Thsd7a UTSW 6 12471158 missense
R8755:Thsd7a UTSW 6 12408852 nonsense probably null
R8843:Thsd7a UTSW 6 12501137 missense
R8867:Thsd7a UTSW 6 12338687 missense
R8952:Thsd7a UTSW 6 12468993 missense probably damaging 0.98
R9036:Thsd7a UTSW 6 12418250 missense
R9299:Thsd7a UTSW 6 12504132 missense
R9366:Thsd7a UTSW 6 12555481 missense
R9489:Thsd7a UTSW 6 12352023 missense
Predicted Primers PCR Primer
(F):5'- GCTTTTGGCATCAGTCTGCATTTCG -3'
(R):5'- TGCTCGTTTCTCTGAGTAAACGTAGTTG -3'

Sequencing Primer
(F):5'- GCTGCAATGTTAAAAATGAGTCC -3'
(R):5'- AGTAAACGTAGTTGTCCTTGCC -3'
Posted On 2013-07-11